Description :
From Genome Similarity Track
Location :
Scaffold_3180:2499- 3553
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_3180-fgenesh-gene-0.0Coated vesicle membrane protein
Pytiw_DAOMBR242034maker-piw_contig_3180-fgenesh-gene-0.2Conserved gene of unknown function

Sequence
1054 bases(100 bases per row)
GTGGGCCTAGGCTCTTTGCGTGGCGTTTGCATGTTACGAAGAGCCGAGCGCTCTGAGGAAATGCGTAGCCAGCTGCAAGTGAACGAAACTCGTGGCTTGC
GCTATGCGAATAAGCACAAAACTACAGGATTCATTTGTTTGAAGCCGACACAAAGTTTAAGCTCACAATCATACACACGTAGCTGCTCATTGTGTGGACG
CCTCTAGCTCCTGGATCAGCGCTTCGCATGACAGGCGCATGGCGTCGAGATCTGGACTCGCGTCCTCGCCTCTCGCTGCTGCGATCCTGATGTGCGTCTT
GCCAGCTACTCTGTCTGACCCCTGATGGATCGTAAGGAAGAAGAGCGCAGCCTCTGAACCAGCAGCGAAGCGATACGCTCCTGTCTCGTGTGTGAGCATC
GCGTCCAGCGGACTCAGACGCAGGATCCCCCTCAGACGCTGCAGGTCGATCTGTGATGATGACGACGCCGTCGCACTGGGGTTGGTTGTCACGTCCTCAG
GCTTCACGGGCTGGAAAGTCGTCGACTCGAAGAGCGAGACTCGAAATGGAGAGCTCTTTTGCAGTGGCGCTTGGGTCCCGGGGCTGCGGAATGCGAGTTC
AGCATGTCCCGCGACTGGCACCATGGACAGCGGCACACGCACAGTGTGTTCTTCACCGGGGCTGAGCGTCTCAAACAACTTGCTAAAAGGAGAATCAGAC
GTTGCAGCAGTCTCGGTATACACGAACAGCGTCACTTCCCCCAGCATGATCTGCGAGTGGTTCGCCACTGTGACGAGGAGCTCTCTGGCCGCGGCGTCGA
AGTGGCACTCGACGCGCAGGTTCTGCAGCAGCGCCGCCTCCATAACGTCGTTCATCATCTGCATCATCTGCGCACTCTGCGTGAGGCTCTGGCCCACGCG
ATCGAACACCGTCGAGAACGACTGCTGCAGCCCGCCGGCGAACTCGTTCAGCATGGCCGCCATCTCCTCCATCTTCGCTTGACAGTTTGCGAAGTAAAAA
GCAACAAAACCGGTAGCCGCTGAGGGTGGACGACATCAACTTTAAGCTTTCCCC