Description :
From Genome Similarity Track
Location :
Scaffold_1:2498709- 2507886
Transcript NameFunction/comments
Phyin_T30-4PITG_00477Ser/thr kinase
Phyin_T30-4PITG_00478Putative uncharacterized protein
Phyin_T30-4PITG_00479Putative uncharacterized protein

Sequence
9177 bases(100 bases per row)
CGATAATTGGACTTGGCAGCGAAAATGGTGCGGGAGTTGGCGTCGCCGATGCGAGCGCGCTCGTTGCATGCCGCCATGGAAGAGGCCTCATCTCCACGCG
TAAATAAGGCGTTGGACTTCATGAGCAGCGACGATGACGACGAAAATGCTGAGGAATTCGAACAGGAGAACCGCAAGTGTAACAACTCCACCAAAGATTC
AAGTCCACATAACACGAAAGCGGCGGCGGTCGGGGGAACCTTTCGCTACCGCACACGGCGCACGGAGCGCTTGGGCGTGTACGGCAGGCAGGACCCGCCG
TATCGTCGGCAAGTACTTTTGTCACCCAATAAGATACAGCAACGACGATCCAGCTCAGAGCAGAGCACTCCGACGCACAGGAGACCGGGGCTTGCCGGAC
GGTAAGCTACTATAAAGGATTGAGAGGGGCTAGTAGAATAACGTCTGGATTGATATGTGGACGAAAGCAGGTCCAGTAGATCGGTGTCACCGCCGTGTGC
GAGCCCAGCAACGTTGCTGAGCCAAAACCTTGGAGCGACTTTGTCTATGAAGAGTCCTGTGCATATGCGGCGGCGCTCGCAAGGGAAGAAAGTAGTTGTG
AAGAAACTTAGTGTTGCAGACTCTCCGGTGAGTTTTTATGCCTCTGTTTGCGGCTGGTGAGGGGGTCTGAAGTGTGATTCCTTGTCGGACAGAACCATTT
TGTCCCTTCGTTTGAAAGTTTGCAAACTATTCGTTGGCTTGGAGCTGGCGTATCGGCAGAAGTATTTAAGGTGTCGCTCTCATTTTCTTTGGCTCGAGCT
CTATTGCGAGTACTTACTCACTCGTGTTTCCCTAACAGGTCCGAGATCCACTGAGTGGAGCGCTGTTCGCCATCAAAAAGTCGAAACAAGAGCTGCGAAA
CGATCGAGAACGGTACGGATTCCAGGCTTTTATGTAATAGTCGATAGTCTCCTTACTTTCTCTGGTGTCAACTTTGCTCGATTTACAGTGATGTGTTGGC
CCAAGAAATCATAATCCTTGATAAGCTAACATCGTCACGACACAACTTCGACAGCATCGTGCGATATTACCAAGCCTGGCAGGAGAATGGTATGCACATC
TCTTTTTTTGCGAACAAAAATGGGGGGGGCTCTGTGCTGATGACAATTGTGCAAATACAGGCTTTTTCTTCTTGCAAATGGAGCTGTGCGAGGGAGGCAC
ATTGCAAGAGTTTATTACGACACGAAACCGAGAAGTTCTTCCCGAATACTACTTGTGGAGTATCTTACGGAATGTTGCAAGCGGACTCGAGGTCCTCGCT
GAACACGGTCTTGTTCATCTGGATATCAAACCTGACAACATATTTATCACGGGAGACGGACATTTAAAGATTGGGGACTTCGGTATGGCCGGAAAAGTGG
TGACATCGTCCAAAGCGTCGAGTACAATAAGTGATCTTGAAGGAGATGCGAAGTACATGGCGAAGGAGCTACTGTCCAGCGCCGATCGGCTCCCTTCGGC
GGATATCTTTTGTTTTGGTACACTGCAACACATTCAAGCACTTCAATGATTATGAAAGTAGCAGAGATACTCATGGCTGTCTTCTGACGTCGTAGGTATT
ATGATGCTGGAAATTGCTACTGGAATGGTCTTGCCAGAAGCTGGGAAGAAGTGGCATGATCTGCGGGATGGAGAATTGCCTTCTCTTTCTTCAGAGTACT
CAAAAGAACTCAGCGAGATGATTCAACAGGTAGGAACGCAATTGCCCGCATATTTTTTATTATTGGTATGGTTGACATTGAAGCTGACTGGGATCTCACT
TAAACTTACAGATGATGCATCCTGATCCAACAAGGAGGCCCAGTGCAGTAGATATCATGAAAAACTGTCCTGTGCAAACTGCCACCGAGCCCATCACGCT
CATCCAAGAGGTACGTCCATTTTTTGTCTTCTTGAGTGTCGTTGAAGTGAAGACAAGTATTTAACCACTCCACTTGCCCTACGAACAGCATGCTTTGAAG
CAAAAAATGGTCGTGCTCACTAGAGTACGAAGCAACACGAGTCGATCGGCAAAAAACAACATGCAGACTCCTCACAAGACGCGTCTCTCAGTACCGTAAA
ATAAAAAAAAATCAATGCACTCTCCAAACCTGTCAATTCTTATTAAATTTTCTGAATTGGTACATTGCTCCTTTTGAGGAACCGGTCAGTAATTCCCCTA
TTCACTAACCGTCTTCATTAACCGCTTATAATCGACCTCTTTTTGGTTGGCTTCGATGGCGCCGACACCACAGCGCCGCGTTCAGTATCTCTTTTCTTAC
GTGATAACAAGAGTACGTCGCCGTGTTTGTTGAAAGTGTCCATGCCATCAGGAATAATGTGCTTACTCGAGTGTGCATGATCTTGTGAAACTACAGTGAA
GTTCAACTCGACCGTGTCCTCGTCGCGCCGCAAAAGCCGTAAGGCCCACTTCGGTGCCCACTCGACCCAGCGTCGTGTGCTCATGAGCGCCCCTCTGTCC
AAGGAGCTGCAGAACAAGTACAATGTAAGTTAGTACACTGGTACTTTCAGCGTTGTAAGTCCATGTCAGAAACTCGTTACGGAGTCTGGCACTTCATGGC
ATCGCGGGAACCGTAAGTGTCGACCCCTCTCCCAGGACGACAGCTACAAACTTCTAGCTTTGATCGTGACTTTAAAGGCTCATGGCATCCTTTTTTATTG
ACACATTTCAGGTTCGCAGCCTGCCTATCCGCAAGGAGGACGAGGTCATGATCGTGCGTGGCTCGCAGAAGTCCCGTGAGGGTCGCGTGACCGCCGTGTA
CCGCAAGAAGTTCGTCATCCACGTCGAGCGTGTGGTGCGCGAGAAGGCTAACGGCGCCTCGGTGCCTATTGGCATTGACGCCTCCAAGGTGGTCATCACC
AAGCTCAAGCTTGACAAGGACCGCAAGAAGATTTTGGAGCGCAAGAACCGCGCCGTGTCCGAGACCGAGAAGGGCAAGTTCACGGAGCAGGACGTCGCCA
TGGCCCAGGTCGACTAAGTGCCACAGCCATCTCGAGCATTGTTATCGTAGAGAGAAGGAAAGATTAAGTGTGGTAGTGCAACATCATGGGAAGAGTGGCA
ACTCTCCTTGGCATTTGCCATCACCAATTACTGTCCCTTGTTTTTTTTTTACGATTGGAGCTTCTTCATCTCCTGTTCGATCATCTGCTTGAGTGAGACT
GTCGGCTGGTCCGAGACGAGTTCAACGAGTAGGTTGATGAAGTCCACTTCGCGTTCAGAGAACTCACGTAATGATAACTCCTGCATCTCGAGACGGCGAA
GTATCTTGTTGCATAGCGGAACCGCCTGTGGAAGCGATCGTTTGACTGTTGCAAGAAGTTTGTCTTCGCATTCTCGAGCGTACTGGTCGCGACGCCAATT
CTCACCTTTGCTTCCAGTTGAGAATGGGCCATGCTGTCGGAGTTTATTCATGCGGTCACCGTGCTTCTCAACGAAGCGGTCGAGAATCGACGCCTTCTTT
TTCTCCTAAACAACATGAAAGCCATCAGTTATCTTCTTTAACATACGCATGATGCTACTATACACGTAGTAATATTCACGCACAATGTCGAGGGAGGCCA
GGTACATTCTGGTGGCAAGAAGCTCTTCGGTCGTAACTGCTTTCTCCTGCAAAAGCTTCTCGTTCTCATGATGTAGTTGATCGGCTTTCTCACGTGCCTG
GTTCATTTCTGCGATCAATCGCTGCTTACTTAGTCGAGTAGCCACCAGATCCTCCTCCTTCTTATTCAGATCCCTATTTCACACAAGTTTTGTTAGCTTG
CACTAGTTTTCAACGCGAGTTCAGCACAACATTTGCCACAACATACCGCGATAACTGATCTACACGCCGAGTAGATTCGCCTGCCATTTTACTATGGACT
TGTTGTTGTCTGCGTTGCATACAAGCCGTGAATTTAGAAAACATTCGAAATTCTCTTGCAGAAATACCAACCTTTCTCTTTTCCGAAGTTCCATAATTTC
TCGCTCCAATGCTAATTTCTCTTCGACTACTTGCCGGTACTTCTTCTTTAATTCAATCGAAGACCCACTTGCTCCCATCACTGCCCCCCCAACTCCGCTT
GCCTGTCCAGTAAACACTCCAGTGAATAAATATTCTTATAATTGAAAGCGCATTACCAGCGGAATTTTGGCATTTACCCGGAGTTCGAGCGCGACATTTC
GTGTTTGAAGTTCTTGCACTTGGGCGTGAAGAGTGCTCAGCTCCTGTTGGTACTGTTTAAATACTTGAGGAAGCGACGTGCGCTTTTCTAGAGCACGCAA
CTTGCTGCGAAGTCCGACATTTGCCAGTTTCATGTTCTCAATATGGACTTCAAACATTGCTCGCGTCTCTTCTTGATCCTGGATTGCTTCAGCTGCTCGA
GCTTCTGCTGCTTCTTTGTCTTGCTGTTGTTCCCGCACAATCGAGAGCAGAGCTTCGTAGTTCTTCCGTAGTAAAGTAGCATCTGCAGCCTGAACTCGTT
CAGCCGTCTTGACATCCAACCCATCAACATTCGGAGGCACCATCACACATGGAGAGATACCAGCCTTTTTAAATGCTTCTAGCTCGAAAGGATCCGGCTT
TGATGACACTGGCTTAACGGCTTCGCAGGGCAATAGTCGTGCTGACATGAGTGTGGGTTCCACCGAATCAACCTCAGGCGAGTCAGTATAAGAAACCTCT
CGATAGCGAGAATTAATCACAGGATGATTGTTTACTGCGTGATTGGATGAATGTAAATCTTCGTCTGGGTGCTGTGATCGCTCGGTGTGATGCTGCAAAA
TTCTTTCATTCTTTGTGCGGCTGTATCCGATGTGCGCAAAGTCTTCTTGATCTGAGCTTTGGTCAAGAATTGGTAGTGGAGTATGGGACTCCGGTATTGA
ACGATTAGGAGGCAGCGAATGGAGCGAGCAATGCGATACTCTTGAATTCTCAGGTTTACCCAATTCGATTTCCTTGACATCTTCCAAAGACTCGCGCACT
TGCTCATATAGATCGGTAATTGAAGGCCGCGTGTCTAGTGTGGTATATTTCTCGTGAAGGTTTTCACTATCCACTCGACTGTCAAGGCCAGACAAAGGTG
CTGTGTCCGATCCCGGCCGTTCAGATGCTTTAGCTGCTATACTGATCGTGTCAATAGATCCACCGAGTATGTTTAGCTTTCGTTGAGCAAATGCATTCAA
CCAGCTCATCGCTTCTGACTCTTCAGCTCCATTTAAAGAGGATGTTGCTGGTGGTTGCTCGAAGGACGAATGCCTCTCCAGCATATGAGAATTTACCGAC
GACGGCATTTCGATTTGTGGCGACAGCACCGATCGATTCGGCGTAGATCCCCTTATCTGTGCTTCCACGATGTATCTATCCTGTTCACTTTGAATGTCAT
GCCGTGGTGGCTCACTTGGAGAAGCTTCAAAACACAGCTGCTCAAAGGATACGCCACGAAGGGGTTTACAAACGCATGTAAAGCCTCGCAGATTGGCCAC
AGCATTCAGCATCTGCACGCTTTCTCGCAAACTGCTGCGTGAGTCGATCACGTTAGCATACAGGAAAGATTTAGCGTTTGCAGTCAACAAAGGCATCATG
AAGTTCGATAGCACCATTTTGCCTGTAAAAACTTGTGGAACTGAGGCACGAGTGCTGCTTTGTCTTAAAGTAGCTCCAGCTTGTCGTAAATCTTGTAAAA
TACTGTAAAGCTCGATCTTTTCTTGTATCGATACTTGATCCTGAAAATCTTTTTGGTCAATAAGGTCCACAAGATGCACACTACTTACTTGGCCACCATG
AAACAACGCCAATCGTACGAAGAAATGTGCATTCTCTGCGTTCTGTTTGCGTACGATACGATTAGTCTTAGCAGTCTGCACAATGCGAAATGCACCAGCC
AGTGATTGCGCTTCCAGCGACACAAACGTCATGGGCTCGGCTGAGGAATTCGTCCTGTTACTATCTGTCTTCAACAAGTCAATCGCTTGGTTGTTTACAA
TAATCCAGCTGCTGATTCCCAGTCTCCAGGGTTCATTTTGAGCTGGCCGAGATCCAATGTCCAACTGAGCAAAGAAAGCGTGAAGCATTCCTACTAGCTG
GCCATACAGCTCTACAACGTCATTCACTGCCATTTCAGGTTGCGGTGCAAAGCCTCCTCCGCCAACGCTTTTGCCGAACAGCAGCCGATATTTTTGAGTA
GGATGTACACCCCACACGACAACGTTCGAGTTGATGCCATCTCGTGCCGTTCGTAGAGCGGGTAACGTGATTTCAGTGAAAAAGTCGATAGCGTGTGACG
GCGAACTCGACGAAAACACGGAATGAAAAGTCCATTCGGCCGTAGAAACCGCTCCACCACTAGAAGAGGTACTTAGCATCCCTGCTATAGACGCATCATT
TGCAGGTTTGTTCGCTACTTTCACGCAGTTTTGTTGCGGAAGAACCTCAAACACAGGCGTGGCGCGATTCGCTGCAGTGACGTAGCAGGACACGTGGATA
TGACTGAGTACCGGAGCTGCAGCATCATTCGCGCTTCCTTCTGCAGTCCTAGCACCATCGTTGAATCCTCCAATGCTACTTCGCTCCATTTTCTAAATAG
GTAAACGTCTGTTCACCAGCATCAGCACTAGCCATAATTAACATTAAAACGACCCAACCTATGTGCGAAGAAGAGCAAAACAGGATAACCATGAAACTCA
TTCATAAAATAAAAATCAAACGCACCAGTGCAGTCACGCTGGATGCCGAATGCTGCGTGCTGCGCTCCAATAAAGACTTTTGCTGCTGCTTCCGACTTCG
TCTTCCCTGCTTGCTACCAATATGCTAGCTACCAATACACCTGAAAGGCCCTCCCATGTCTCTGTCACTCTAGATTACATTATACTTGCTTGATGTGTGT
TGTATCCGCTGCCAAGGTGCGGAGGTGGTGGCAGTAATATCTTGGCGTAAAGAAGGCAAAAAAATCATCCCGGTCTGGATTCACGGCTGTAGTTCGCATG
TGGTCAATTGCTTCGCCGCATCTGCGAACGTTGGAGCGTCGTATGCCGGTCGCAAGAGCGAGAGCGAATGAGATCCGCCGTCTGTAAATGCGATCTCGGA
CGTCTCATCGTTCATCTCGTCCATGACGCTGTCCTCCAAAATCTCCGATCGCTCCAACGCCACGTGCATATCCGTCTTTTGACCGACCGTCTCGACAAGT
TCGTCAAAAAGTCCGATCTTCCACGCAAGATGCTTCTCCTCCAAGAAGTACCATACACGGTACGCGTTCCAGAAGTGCGCGTTGTCCAGTTTCTTCACAA
GTGCGCCGTTTACAGTATCGCGGAACACTTTCTGGATTCGCTGCACGTCGACATCTACATCGCTCAGGTCTACACCGTTGTTCACAAGGAACCGCAATAA
AACCAGCAGTTCATACTCGGACGGACGGTAGTGACCGCTGTGGGGATAAATAGTTTTAATGACCCCGTCACTGATCACCATCATTCCTGCTGTCTGCACA
CATTCGCCTCCTACGAAGCTCGTATGGTGGATTCGAGGGATCTTCTTCGTCTCCTTCTGGGAGCCGTAAAGAACACCATCGCGTAAAACAAATATCCATC
CATCGGGTCCAGTTTCCACGATCTCTTGCGAGACATCATGTACAATCTGACCGTTCTGGACCGAGAGCGCAAACTTCTGACGTTCAGCCGCCGTGTCACA
GTACAGCACAGTCTCGCGTTCTAGTTTCGTTCTCGGTACACCAGCGACTTCAATAGATTCGTCGTCCAGCCACTCCCAGAAGCTCGGCTTTGTGGGCTCC
ATTGGCTGACGCTTCCACTCCTTATAATATGCTCGCAAGTTTGCTCCATATCTGTGTATTAAAAAAAAAGTTCACATTAGTTGCAAGCGGTTTCCTAAAT
TATCTTAGGAAACGCGAAGAACGTACCGGTGCTTACGGTCGCATACTTCCAGCCAGCTTTTTTTATCCACGACAGAAATGTTTCCTGCGCTGTAGCCCTT
CACTAGCTTGGGCGAGTATTTCTTGGCCAACTTGACGATCTCGTGCATGTTTTGGTAGGTGGTTCGTCGTTTGGCACGCATGCCCTCTGCTGTCATCTGT
TTGGTTCCGCTGGTTTCCTCCGTTCTTAAAAAGATTTCGACTAGATTCTGCGATGCCTGTGTGTGCAGTAGTTAGCCCACTCCCGTCTCGTGTTCGGACT
CGGTCTCTGTTGTCGTCGCCACGGTGCCGTTTTTCAATATGTCGTGGCAGAGTTATCTACTGACAGCGCTGTGTATGTGCGTGCTTTGTGTGTGTTAATC
GATCGAAGCCCAGGGCCAGATGACGTCTCGGTTCCTCAAGTCCAGCTAACTGCAAGAGCGCAAGCGCAACAAGGCAGCAAGTGGCACACACAGAAAGAAA
ACAGACAGCTTCTTTTTGCTGTCCTGTGTGTGGCGTAGGAAGGGACAAATGGCACAAAAGGAGCTCGTGCACAAACGGCTTTTTAGACGTGTGTGATTCG
CTCTGCAACTTGTTTTGTGTGTGAGGATAAATCTCACTCTTCTTGGCAAATAGGATTAATGCGACAGCTGCACTTAGTACTGCAAACACAAAAGCAAACG
CAGCATACAATCAAACACATGTTAGTAATCGTTAGTCAGGACCGAGTGTCCGTCACCGAGGACTCTGAGGCGACGTGCGCGCATGCAACAGCTGCGTAAT
CTGTACCTGTTTCTCTTTTCTGGTTTGAGCCTTCTCCTCTACAGCGCAAATTCTCTAATGAAGGCAACAGACCAAAAATCGGGTAAAATGCCCGGCTCTG
TGCGAGGGAGAGTACGGTACCGCGGTGGGTCGGGTTAAATTTTAACCAACTAGATCTCCTAATTAAGATTTTGGCCAATAGGTAATCACTTCATGATCCA
ATTTTAGACTAATCAGCGATTTCCTTAGACAGAGCCCTAACCGGTCCAGACAGTGAACCGTACAATTTCATCTTCGCCAAGAATGTTCGGTGATGCACTT
CAAAATTGCAATTGGCGGCTTCGTGCAAGGTGGCAGGTAGATCACGTGAGACGACTCACTGCTGTCGCACCATTTTTTTTTGTGCCATGGGCCAGCAGCG
GCGATGTGAACGCGCGTCAAGATTCTTCTCAAAAAATAGTTTGGTATCTGCAAGATTCAGCACCTGCAACGCGACGA