Description :
From Genome Similarity Track
Location :
contig_33:249840- 251695
Transcript NameFunction/comments
g8016.t1RAW25421.1 Lysosomal beta glucosidase [Phytophthora cactorum

Sequence
1855 bases(100 bases per row)
ATCCAGGAGATCACGATGGAGGAGAACGGAGGCCACCCCGTCATCTACGGCATTGACTCCGTCCACGGTGCCAACTACGTGGACGGATCTGTGCTGTTTC
CGCAGCAGATCAACAGCGGCGCGAGTTTCAACCCCGACCTCGTCCACGAGGTGGGCCGCATCACTGCTCGTGACACTGGGGCCGCTGGAATCCCGTGGAT
CTTCGGGCCTATCCTCGACATCTCGCAGAACTCGCTCTGGTCTCGCACCTACGAGACGTTCGGCGAAGATCCGCACTTGTCCTCCGTCATGGGCGCCGCT
CTTGTCCGCGGCCTCCAGAGCCACAACCAGACCGCTGCCTGCATCAAGCATTTCATCGGCTATTCCAAGACACCCAGTGGCCACGATAGAGACAACGTCA
TCATGGGCGACTTCGACCTGCTCAACTACTTCCTGCCCCCGTTCAAGGCTGCGATGGAAGCCGGCGCGCTGTCCACCATGGAGAACTACATCTCTTTGAA
CGGCGACCCCGTGGTCTCTAGCTCCAGAATCCTTAACGACCTTCTACGATCGGACCTGTCCTTCAACGGGGTCCTGCTGTCCGACTGGAATGAAATTTAC
AACCTCCACGACTTCCACCGCGTCTCCAGCACCCGCGAGGAGGCCGTGGCCACGTCTCTCAAGCAGACGTCGATCGACATGAGTATGGTGGCGACGGACA
CGGATTTCATTGAGTACGGTCTCAACATGCTCAAGGAGAACCCGGACCAGGAAGCTCGACTGCGCGAGTCTGCTAAACGCGTCGTCAAACTGAAGCTTCA
GCTTGGACTATACGACAACCCGGTGCCTGGCAAGGAGAACGTGGCGATGGTGGGTAACGACAAGGACAAGGAGACTGCGCTGGAGATGGCGCGTGAGTCC
ATCGTGTTGCTGCAAAACAAGAACGACACCTTGCCACTACCAAAGACCGCTTCCGTCTTCCTCACAGGCCACTCGGCAGACAACGTGGGGTACCAGTGCG
GTGGCTGGACCTTCATCTGGCAGGGCTACTCCGGTAACGACATGTTTAACAACGGCATTTCGATTCGCAAGGGCCTGGAGAACCTTGTCGGCAACGACTC
CTTCACGTACTTTAACGGTCTGCTCGCGAACGGGTCGATTTCGGATGCTGCTCTTGCAAAGGCTGTCGAGCTTGCCGGCCAACACGAGTACACGATCGCA
GCCATTGGTGAGTCGCAGTACACGGAGAAGCCCGGTGACATCGACGACCCTGCACTTCCTGAAGGCCAGGAGAAGTTCATCGAAGCACTCGCTGCCACGG
GCACCAAGGTGATCGTGGTGCTTATTGAGGGCCGCCCGCGTCTTCTTGGCTCGATCCCCGACCACGCCGTCGCCATCATCGACGGAATGCTGCCGTGTGA
ACTCGGTGGCCAAGCCATCGCAGAGATCATCTACGGAGACGTGAACCCGAGCGGCAAGCTGCCCATCACGTACCCGAAGGACCCGGCCAACATCGCCATC
CCGTACAACCACCGCGTGACCACGCGGTGCATGTGGGACAACTGCTGGATGCAATGGGACTTCGGCGCCGGCCTCAGCTACACGAAGTTCAACTACTCGT
CCGTGACGCTAGACAAGACGACCATCACCAACGCGGACGACACGCTGACCGCCACGGTGACCGTCACGAACGTCGGCTCGCGCACGGGCAAGGAGACGGT
CATGCTGTTCCTGATCCAGCCGTTCCGCAAGATTTCGGTGCCGGAGATGAAGATGCTCAAGAAGTTCAAAAAGATCGAGCTGCAGGCGGGCGAGTCCACG
GACGTGTCGTTCTCACTGTCGGCGGAGGACTGGGGCGTGTACGAGCCGCAAATCG