Description :
From Genome Similarity Track
Location :
contig_33:249837- 251692
Transcript NameFunction/comments
g7648.t1RAW25421.1 Lysosomal beta glucosidase [Phytophthora cactorum

Sequence
1855 bases(100 bases per row)
ATCCAGGAGATCACGATGGAGGAGAACGGAGGCCACCCCGTCATCTACGGCATTGACTCCGTCCACGGTGCCAACTACGTGGACGGATCTGTGCTGTTTC
CGCAGCAGATCAACAGCGGCGCGAGTTTCAACCCCGACCTCGTCCACGAGGTGGGCCGCATCACTGCTCGTGACACTGGGGCCGCTGGAATCCCGTGGAT
CTTCGGGCCTATCCTCGACATCTCGCAGAACTCGCTCTGGTCTCGCACCTACGAGACGTTCGGCGAAGATCCGCACTTGTCCTCCGTCATGGGCGCCGCT
CTTGTCCGCGGCCTCCAGAGCCACAACCAGACCGCTGCCTGCATCAAGCATTTCATCGGCTATTCCAAGACACCCAGTGGCCACGATAGAGACAACGTCA
TCATGGGCGACTTCGACCTGCTCAACTACTTCCTGCCCCCGTTCAAGGCTGCGATGGAAGCCGGCGCGCTGTCCACCATGGAGAACTACATCTCTTTGAA
CGGCGACCCCGTGGTCTCTAGCTCCAGAATCCTTAACGACCTTCTACGATCGGACCTGTCCTTCAACGGGGTCCTGCTGTCCGACTGGAATGAAATTTAC
AACCTCCACGACTTCCACCGCGTCTCCAGCACCCGCGAGGAGGCCGTGGCCACGTCTCTCAAGCAGACGTCGATCGACATGAGTATGGTGGCGACGGACA
CGGATTTCATTGAGTACGGTCTCAACATGCTCAAGGAGAACCCGGACCAGGAAGCTCGACTGCGCAAGTCTGCTAAACGCGTCGTCAAACTGAAGCTTCA
GCTTGGACTATACGACAACCCGGTGCCTGGCAAGGAGAACGTGGCGATGGTGGGTAACGACAAGGACAAGGAGACTGCACTGGAGATGGCGCGTGAGTCC
ATCGTGTTGCTGCAGAACAAGAACGACACCTTGCCACTACCAAAGACCGCTTCCGTCTTCCTCACAGGCCACTCGGCAGACAACGTGGGGTACCAGTGCG
GTGGCTGGACCTTCATCTGGCAGGGCTACTCCGGTAACGACATGTTTAACAACGGCATTTCGATTCGCAAGGGCCTGGAGAACCTTGTCGGCAACGACTC
CTTCACGTACTTTAACGGTCTGCTCGCGAACGGGTCGATTTCGGATGCTGCTCTTGCAAAGGCTGTCGAGCTTGCCGGCCAACACGAGTACACGATCGCA
GCCATTGGTGAGTCGCAGTACACGGAGAAGCCCGGTGACATCGACGACCCTGCACTTCCTGAAGGCCAAGAGAAGTTCATCGAAGCACTCGCTGCCACGG
GCACCAAGGTGATCGTGGTGCTCATTGAGGGCCGCCCGCGTCTTCTTGGCTCGATCCCCGACCACGCCGTCGCCATCATCGACGGAATGCTGCCGTGTGA
ACTCGGTGGCCAAGCCATCGCAGAGATCATCTACGGAGACGTGAACCCGAGCGGCAAGCTGCCCATCACGTACCCGAAGGACCCGGCCAACATCGCCATC
CCGTACAACCACCGCGTGACCACGCGGTGCATGTGGGACAACTGCTGGATGCAATGGGACTTCGGCGCCGGCCTCAGCTACACGAAGTTCAACTACTCGT
CCGTGACGCTAGACAAGACGACCATCACCAACGCGGACGACACGCTGACCGCCACGGTGACCGTCACGAACGTCGGCTCGCGCACGGGCAAGGAGACGGT
CATGCTGTTCCTGATCCAGCCGTTCCGCAAGATTTCGGTGCCGGAGATGAAGATGCTCAAGAAGTTCAAAAAGATCGAGCTGCAGGCGGGCGAGTCCACG
GACGTGTCGTTCTCACTGTCGGCGGAGGACTGGGGCGTGTACGAGCCGCAAATCG