Description :
From Genome Similarity Track
Location :
Scaffold_66:249827- 255384
Transcript NameFunction/comments
Phyra_82013NRPS-associated AMP-binding protein
Phyra_82014myosinlike protein putative

Sequence
5557 bases(100 bases per row)
TGCCATTCTTGGTCTATCCCGCCGAGCAACAGAGCAGCATGGCATCAGCCGCGGAGATCCGCGCCGAGAACGAGCGCCTGTCGCGCGAGATCCACGCGCT
GCTGAGCGCCAACACGACGCTGCAGAAGCAGGCGATGGAGCTCGACTCGGAGCGCGACGCGATTGAGGCCTCTGGCAGCGAGAAGGTGCAAACGCTGGCG
CACGAGCTCGAATCCGTCGATGAGGAGCTCTCGTCGCTGCGCTCGCAGTGCAGGTCCATGACGGAGATCCTCAAGAACGCAGACGCCCAGAACGAGGTGG
ACGAGGAGCCGGCACCGTTGCCAGGGAGCCGTAAGCTCTCCACGGCCATCAACCAGACGCTGCAGCGTGCCAGGGGCATGTCGATGCCGCGCCAGCGGCG
CTCGTCCACAGTGGATATGATGGCCCACGGGCTCACCAAGGCGGCGAGCTACATGATCCCACCCTCAGGAAAGCACAGCCCCGACGGGCCTCGTCCGCCC
AGGATGAACAAGGACAGCCCGCCGATCCTGTCGTACGCCAAGGGCACCACGGACTCGAAAAAGAGTCTGTTGTTCTCCACTCACTCGCACTACGGCAACT
TCCGACGGCACAGCGGACCCTATCGCAAAACCCGCGATACCGTCATGCGCATATGAGTTGCCTGTCCATCGCGTCGAGCCCACCCCGGCAAGAGAGAGAG
AGCACTACCTTATTTAACACCAACCCAGCATGTTCAGCCATTGGAGCAGCTAGCTATCCGTCTAGTCGAGCGTCGGGCGTCACGCCTGCAAGATCACACG
TCCAGATCACTCACCACCAGGCATTCTGCTGATATCCCCCGCTGCATGTTTTTCCGACGGGCAGAAAAGCAAGCAAGGGCAATCGTTGGTTCAAAGTTCG
AGTGATGAACCACCAGAGAAGAAAGTCTTGGTATCCGCTATGCGTTTCATCGTACTCAGTCCCAGTTAAATACAAGTGCCGCATCACGTTGTGCTGGCCT
TCATCCCCTGCGAATCGTTTGCGGTTGTTGTTGCTGCTTTTCATGCTGCCTGAGTCAACTCGACCACAAGACCCTGACAATCAACACCAAGCACATCGAC
GATGGTTGATATCTTTATTATGGATGGCTGATGGTTGATACAAAGCTAACTAGCTAGCTGGACAACGCACTACTACTAGAGGGTGACACGCATATAATCG
AAGCGCCAAGAGCGGCAAACACGCTAACCTGCGAATTCGTGCTGTCGCCCCTGGCGTCTTTTCGTCTACTTACAGCGCGTTGGCCGACTTCTGGCGTGCC
AGCTTCTGCGCCTTGAGCGAGGCCAGCGTGGGGCGCTCGAACTGGGACTTGCCGAGCTTGCGGTTCACGTAGTACACGCGGCCCGTAGAGCGCGACACCT
TGGCTTCCCAGCCGACAGGGAGCGATACCTCCGGCAGAGCATCCAAGTTAAACGACTCGCGCACAGGGCGATCCACTGCGGGTTTCGCTGCCGACTTCAC
CTTCGCGCTCTTCGAGGTAACGACCGTCGTCGATGCGACGTTGTCGGTCGTGCCCACCGTGTTGTCCTCAGGCTTGCTGTTCGTGCGCTTGTTCCGGGAC
GCACTCTCGTACATGCCCTTCACGACGGACATGCGGCCCTTCAGGGTTGACATGGCACCCGTCACGCCCACCTCCATGCTCTTCACGATCGTGTTTCGCG
TGGTAGCGTTCGTGGGGCTGTCCTCACCGTCGACCTCCGAGACGTCGAAGCCGTCGCCGTTGTCGCCCTTTTTGTTAGAGTTCCAAAGGCGAGAGGCCAC
GCTCATGCTCGGCATGCGCGGGAAGTGGCGCTCCGACGCGCCCGACGAACCACGGTTGAGGTCATCCGAGCCGGTGAGCGAGTCCATCAGCACGGTCTCG
CGCGGTTTCTTCTCCTTCTTGGAGCCCAGCGTACGGAAGATCGACTTCTTCTGCGTGGACTTCTTCTCGGGCACGCCTTCCACGTGCAGCTTAGCAAGCT
GCTCTGTCAGCTTCTTGTTATCGGCCTCAAGCTGCTTGATCTTCTTGTCCTTATCTCGCACAGTGTCCTGCAGCTGACGAACCTTGACGTGGTTGCCAGC
CGAAGAGAACTCCTTGTCGCTCTTGAACTTCTCAATTTCCGCCTTCAAGCCCTTCATCGTAACCTTCATGTCCTCGTTCTTCTCACGCAGCTTCTTGTTC
TCGTCCGTGAGAGTCTCGATCATGCCACCAGCGTCAGCCATGACCACACTGGATGCAGCGGACGTCTCCGCCACGCTGCTGCGGCGTTGTAGTTGCGCAT
TACGCTCCTGCTCATCTTGCAAGGCTGCCTTCAGCTTATTCAGCTGGTAAGCCATGTCAGCCTCACGACGCTTCTCTTCAAGAGCAGCCCGATACTTCGG
CCGCTGGATCGTCATACGAACCACAGCCTGCACGCGAATAACCATCGCGCGCATCTTAACGTAGCGGTGGCGCTTGACAAAGCCACGCACATACCGCTGG
ATGATAACAGCGTTGTGGTTGCTCTTCACATCGGCAGCAAACTTGCGGCCCTGAATGCCTCGCCAGTGAGCTTGCGCCAAAGTAAGGCCGTTCAAGAACG
TGTTGTATCTCCGCATGGCGATAACGCACCGGATCACCGACTGCAACTTGATAATCGCTTCCAGTTGCCGTAGGTACTTGATACGCTGAGTGAAGCCAAC
CATGACGTTCTGCAGATATGTGGCCTTGGCATCGAGGAATTTCTTACGGCGGTCCTCGAGCTCTTCAAGCACACCCAGCTGGAAGTACACACGGGTCTTA
CCCATCTGGTACTGCGTGGGCGACTCCAACTTCAGCTTGTCCATGAGCAGCTGGCACTTGTCTGCCGGCGTCTCGCCTCCGCTCGGCACAAACAACCAGA
ATTTGCCCAAAATCTCCGTGTGCTGCAACCGATTTGGGTACGCTGCGCGCGAAATACGAATAGCCTCGATCACACCAGCGCATCGCAGCTGGGACACCAC
CATGGACTGGTCCATGACTGTCGCGCTCTTGATCGGGTTGGGCTTAATGCAACGCACATAGTGCACACGGGTCGAGTTGATGGTAGCCATTAGCTCCGTC
AAGCTTTCTTTGAATTGGGTACCGACCGTCGTAATCGACAGCGCACCACCACGCTTGCGGCGGCCACCAGAAGCGGCTTCTGCCGCAGTCGGCTTCGGCT
CCGGCTTCGGCTCGAAGAGCTTTGCGATGAACGGCTTCGACGAACCACGCATGAGCTCAGACAAGTCAGGCAGCAGCGAGTCCTTGTGCTTCTCCAGGAA
ACCGACCGAGTCGTACATGACAGGAGCAGCATAGTGCTTGATAAGGAACTCGGTCCGCGATGTACGAGGGAACTCAATAACGTGCGCCATGTCATCCTTG
TGCAGCGACGTCACCTTCGACATGAAAGACTCCTCGTTACCCTTAGGTCGCATCACCTCTTCGTTAAGCAGCGAGATGATACCCATGCGCGACTCAATCA
CGCTCAGCACATCCTGGTTATCCGCATATTCAATGTGGTCCCACACGATACCTTCTTCCTCGTACTCAATTTGCACGGTCTTGAACACATCCTGTGTGAA
CTTCTGTTGAAGCTTCTCATTGGCGTAGTTGATGCAGAACTGCTCGAACGAGTTGTGCTTGAAGTGCTCGAAACCGAAGATATCGAGCACACCCACGTGG
TTTGCCATGTTTGCATCATCGGCAAGCGACTGGTTGATGGTAGTCACCAGCCAGTCGAACACGTTGGAGTAGATAGCCTTGGAAAGTGCATCACGGCAGT
CCATAGCCAGTTCCTTGCGCAGCGGCACGCTGTACACATCATTCACGGCACGCATGGTACGCGAACACAGCGCAGTCTGAAGCGCTTCCCAGGTGACACC
AAGCATCTGAGTGGCAGCATTGGCACCACTGTCGCCTTCGATAATGAGAGACTTCTCGTCATCCGATGGGTCGGACTGCAGTTGCGCCTCACCAAGGTGG
AGCACACCGGCAAGCACCTCGAATAGCGGCCGCTGATCATCGTAAGACAGACCCACAAGCTCCAGCGCCTCACGCGTCTTCTTGAAGTGCTTCTCATCCG
AGAGTCCTTCGATCTTCTGTGCTGTGTTGTCGCCAGTGTACACGTAGTGCTTTGCCGAGTCGAGGAGCAGTTCCGGCGCAATGTCGGAGCTATCCAGCAG
TTGGTAGAAGATGTGGTAGTTGCGCTCGGGCGCTTCGTGCTGAATGACACGAGTCTTCTCCAGCAGGTACGTGCGACACTTGGCACCAACAAGCGTGCCG
TTCTGGTCGAACTGCAGCTGTGTGAACTTGCCGAATCGACTGGAGTTGTCGTTACGCACAGTCTTCGCGTTACCGAAGGACTCCAGCAGCGGGTTCACCT
CGATAATCCTCTTGATGGTCGAGTTGTTCATACCACCAGCAATGGTAGCCAGGTGGTTCATGAGGATCTTGGTGGTCTCCGTTTTACCAGCACCGGACTC
ACCACTCACCAGAATGGACTGGTTGATCTCGGAGCGGCGCATGTTGTCGTAGGCCGCCACCGACGTGGCGTACACGTGCGGCGGAAGCTCCTCCTTGGGC
TGGTTGAGGTATCTCAGGTGCTGCTCCTCGGCGTAGAGGTCTGGCAGCCACTTGTACGGGTTCACGGCGATGCAAATGTCGCCCGTGTAGGTGTACGGCA
GCTCGCAGAGGAAACGCTTCTTGACATTGTACAGGATGGCGGCCTCGTGCAGGTAGTTGAGCGTGATCATGTCCTCAATACCCTCGGGCCCGACGTTCTC
GTTCTGGTAGGGCAGCGACTCGAGCTGTTGCACGGCCAGCAGCGCCTTGGTCTTCTTGGACAGCATGTCCACGCAACGCTCCTCGGTTTCGCCGTCGGGC
AGCTCCACCTTGCACGTGATCTTGCGGATCTTGCCGTCGCCCGAGTTCTCGTCGCGCAGCACCTCGGCTGCAAGCCATACGTGCGTCTCGTCTGGCACGA
AGCACTTGGCTCCCACCACCATCTGCAGGTCGCTCATGGTGTCGTCGAAGTCCCTTGGAGGCTCCCCCTTTAACTCAGGCGGAGAGGTGCGCGGCTGACG
GCCCAAAGCGGAATGCGGCAAGGGGGGCCAACGCACCAAGGGGGCAAGATACCGGTAAATGGAGCCATCTTGTCAACGAGCAACTCGACTAACTTGCGAT
TTGTATGAGTTGCTCTGATCGGGCAACTAGAGGTTAGGGAACAGCGCAGCTGTGCGCCAACACCGGCTGGGATCGAGGTCGCCCCGTGAGGATTTGTGCA
CGCTGTGCCGGCGAGTAAAGGCCCGAATCGAGCGTGCGCCACAGTAACCACGACCGCGTGTCTGCTCAGATGACAGTAATTGCGATGCGTGCTTCATGTG
GTCGCGTATCCCAGCCAAAGCTTCTCAGGCGCGCGTGCAAGCATACCACCAACATGGCCTCAAAAAAAATTGCGCCGGTCGTTTTCTGCTCGACATGATT
TACCGCGAATGGTACCGGTTTTACTTATCTTATCACACGGCATACCTTGTTCAAAAC