Description :
From Genome Similarity Track
Location :
Scaffold_199:24982- 26903
Transcript NameFunction/comments
Phypa_INRA-310PPTG_19837hypothetical protein
Phypa_INRA-310PPTG_19838hypothetical protein

Sequence
1921 bases(100 bases per row)
ACTTGTGAAACCCACGATGACAATTTATACACTTGCTCTTTTGTGGCCTCGGTTTGTTCTGAAGGTTCTGTCTGATCTCTTTGTTGTCCCGAGCATCGCC
GTTGGAAGATTTCTTTGGTGTGAAGGCCTGGGAGCTCTTTGATTCCCCCTCAAGAGCTTCTTCAGCAAAACCTTCTGCAATGACTTCCTCAAGGGTCTGA
GGGTTCTTACGAAGGATTTGTTTGCGCAATTTGGCGCTAGTCAGGCCCTTCAGAAAGATCTCTTTGGCGAAAGTTGGTTCCAGTGGAACTAACCTGAGTT
GCTCTTGGAATTTAGCGACATATCCGTGGTAAGCACCACGCTGCTTGATGTTGAGCAGAGCCGTTCGCATCTTCTGTTGGAAGTTCGGTTCTTTGAAGTT
CTTTTAAAGAGAATACTTCATGGCACTCCACGTCTTTATCGTGTCTGGACGCTGCATATACGTCTCGTACCAAGTGATGGCGCTCTTTCTCACACATTGG
CCCAAGTCTAGACCAACGATGACTCCGTCCAGCTCTAGGTCGTAGCCTTTGAAGGCAAAATAAGATTCGAACTGGAAAATAAAGCTGTTAAGCTTGACAC
CATCAATGTCGCCGTCAAACGTCGGAGGTTTGGTGTCCATCTTTCGAAGTGTTCGGTTGCGACCTCCTAATGACATATTGGCGTCTCCTGCTTGGTGAGC
CGTCGGTCTTTGGGTTGGCGTAGCCGGCGCTGTTTGCATGGGCTCATGAGCTCTAAGAGCAGCAGTTTGTTGGCTTTGCATCTCGGTAACAGCAGCGGCA
ACTCGATTTGCCATCTCATTCACTTGCTGCACACTTGCAGCGTTCTGCTGGAGTTCATGGAGAGCAAGAGCCGTATGATTAATAGTTGTAGCTGTCTGTT
CCGCAAAAGCCTGCATCTGGCTTACAATCTCAGTGTTCTGATTCGCCGTTTCTTGATTCCTCTCGACAACACCAGACAGCAGTTGAATGCCATCGAGCAC
GCGATCAAGCCGTTCGTTGACTTGACCCAGGCGACCATCGAGTTCTGCTAATGACTCTTCAACAGAATTTATGCGATCCGTATTGTAGGACTCGCGGTTG
CCATCCTCCAACAGTCGGTGACTAGGCGCAGAGTCACTGCGGCCCAACCGGGTGGCAACACGTCGTCTTGGTTCCATCTTTTGAGAGTTGGTCGTTGAAT
CTGCAAACTCTTCTATGTCGCAATAGATTTTATTATCCACCTTCCTCGCACGTCCGCGGGGTATGACAGTGTTATGGTAGTGGTGGACCAATTGACGAAA
CGGGCTCACTTTATTCCTGCAATGACAACTGATTCAGCCAAGGATGTCGCGGTGCGATACCAGCAGAATGTGTTCAAATTGCACGGCCTTCCTGAATTAA
TTCTCAGTGATCGTGACTCCAAGATCACATCGGCATTTTGGACGAGATTGTGCTCTCTACTACAAGTGGAGCAAAAGTTGACTACTGCTTTTCGACCCCA
AGGTGATGGAGTTACTGAACGACTCAATCAGACCATCGAAAACTATCTACGGGCTTTTTCCAACGCTGATTCGACTGATTGGGATATTCTCTTGTGCATG
GCTGAATTTGCTTATAATTCCCGATATCATTCTGCCATCAAGATGACTCAATTCGAAGCAGATATTGGATATATTCCTCGGACACCAGCTACACTTGGAC
TGGCCAGCGACCCGATACTTCGAGAAAAAAAAAGACCCACGACTGGGTCATGAATTTGCTGAAGTACAGAAGGACTTACTCGCTAAGGCTCGCCGGTGTA
TCAGTGCTGCTCACGATAGAATGGCTCAGTACTACAATCAGAACCGCCGACCTCAAATGTTCACTGTGGGAGACGAAGTTCTGCTGTCTGGGGTAAATCT
GGCTGAAAAGCATCTTGGAAC