Description :
From Genome Similarity Track
Location :
Scaffold_301:24982- 26713
Transcript NameFunction/comments
Phyke_g8628hypothetical protein PHYSODRAFT_535936

Sequence
1731 bases(100 bases per row)
TAGTCGACCTTGATGGACGCGTAGATCTTGCGTGTGAACCACAGCGACGCACCGACGCCCACGGCACCCGTCAGCAGTGACAACGCGCCTGAGATGACCG
CCATGTAACCGAAGTAGAGCATGGCACCGATGAAGTTGGCGACGTCCAGACGCGTCCAGAAGTAATACGTCGAGTAGAGGAACACGTAGCCGCCGCAAGC
TCCTGACACAAAGAGCGACCGCCACCACctgcacagcaaaacaacGTCAACGAGGCATACGTCAGTCAAACCATACATTAAACTTCACTGAGAAGGCTTT
CCAAACATACCAGTTGTAGTCTTCGGCGCAGAGCTGGAAGTAGGTGAGCACGATCGTAATCTCTGCACACGTGTTGATAAGGATAAGGAAGGCAAGCAAC
AGGAAGCCGAACACGTAGTAGTATTTGTCCGTccacagcgacgacagcacgaagaagagctccaCAAAGATGGCACCGAACGGCAGCACGCCGCCCACGG
CCGCTGCAGTCATGTGGGTCATGTACCATGGTTGAGGAGGCACAGGGCGCGGGATATTGCTCGTTGCTACCGGGAACGGAACAGGCGCTTTCCTGTGGAT
AGTTACAAAGCAAAACAGGTCATCAGCTGCCTATTCACGATTCACGAAAGAAAATCGGCGTGCAAACGTACCTGAAGCCAAAGTAGGCACCAGCAAACAC
AAGTGGCACAGAGATACCCGTCCaaaggaagaagacaagcagAATGGAACCGAAAGGCACAGCGGCGTCCGAACCAGCGCCCCATACGAAAAGGTTTAGG
AAAAAGAAGAGTGAAAACATGATGCCAGGGAACAGCACGGCCGTGAGCACCGTGCACAGCTGCCAGCGTTTGCCCTTGAACATTTTGTATGTGCGCGCCG
ACGTGAAGCCTGCCAGCATacccagcagcacaaagcaGACGAGCAGCGCGATCACAAGTTTACCTCGGTTCGAGGGCGCCAGAAcgcccacagcagcaaa
gaaCAGCGTGACGAGCGCCATGCCCAGCAACTGACAACCTGTGCCCACCATCACGCAGAAAAGCATCGGGTTCTTCGACGGCGGACGGAACACGTCAGCG
TGCACAAGCTTCCAGCCAGATTCCTCGCGCTCCTCAGCGCGTTCTTCCTCCGTAGGCACGCGGTTGTACCGGCTGATATCACGGTGAAGACTGCGCATCA
GAATCATTCCCACCATACCGCtcaggaacagcacgatcaCAAGTGCATTAATGATGGAGAACCAGTGGACCTCATCGCCTCCCGAGCCAGCGTCAAAGTA
TACGTCCCACCGCGTACGCCACTCGTGCTCATTGTCCTGCACCCACTCCACACTGTAGGTCCAGAACACCGGCATCTTGCCATCCTTGTTCTTGCGTACA
TACAGTGGGCGCTTCAACTCGCTCGAGTGTTCGCACGAGTCCATCCGGTTGAGTTCCTTGTCGTAACTCTTGGTCGAATAGTCAAAGCTGTAGGGGATGA
CCTTAAAATCCACGATGCGACCTTCATCCTCAGAGGCCTCAGCTGTGCCCAGtgggttgttgttgtagccGATCAAGATCTTGACGTGGTTGTTGAGCTG
CGgcaccacttccacctcAGGATTAAAGCTTCCCAATGGGAAGCCTACCGTCATGCCACCTTCAGAAGACAGGAAAGTGGCTGGCAGATTGTCCAGGATC
CAGTTGACGCGGTACGAgtccttgatcttgt