Description :
From Genome Similarity Track
Location :
Scaffold_36:24980- 26389
Transcript NameFunction/comments
Sapdi_VS20SDRG_10503hypothetical protein
Sapdi_VS20SDRG_10504hypothetical protein
Sapdi_VS20SDRG_10505hypothetical protein

Sequence
1409 bases(100 bases per row)
CTATGGCCAGTTGGACGTCGCCGACGACGCCGACCTCGTCGCCGAAGAAGCAATGATGGAGGCCCGACGCATCCAGGAAGCCATTGCGGAGTGGGAGCGC
AGAGAAGCCGAGAAGCTCGAGGCGCAGCAACAGGTAACACCATTGGTTGCATGGCCCGAACGCACGACTCATGTCTGTCTATGCACGTAGCCGGCGCCGC
TTCTATAAGGCACACGACCCAGACAGCCTCGAGTCTGCGAGCAACAACCTCACTACGCCCTTTAATTCTATCTAATCGTGCCAGTTCGACTTCATGCATC
TTGCTGACATGGCTCCTTGCGTCGCGATTGCATACCGCTGCATACAAAGAGCATCCTGCACTGGGAGCTACGCGTCCACGAGTAGCTAGCTCCCACAGTC
TGGATCGACGTTGTTGACGCACGCGTCCAAACAATCTATATATTGCAATTAAGTTGAGGTCGTTCGTCGATGCAAACGAGGCCATATTAGCCACGTATTT
ATTGACGGAAGTGCGTGATGGGTTCCATCTTCTGGTGGGCGGCGTAGGCCTTCGTGGCCTCCTTCCATTCCGCCGACGTCGTCTTGGGCTCGCCAGGGGC
AGCGCCGCCGAAGTCCTCACCTACAGATCGCATGAGCCATGAGCGTTCGCCATGGCGTGTGGGTACCCGAGTAGCGGAGCGAGCCAAAGACGGCGTACGA
GCAGGCGAAGCAGCCGGCAATCGAGACGCCAATGGCCTGCGTCTTGGGCAACTTGGTCAAGAGCTCGTACAACATCTTACTTCGAAGGTGAAATGGGAAT
AGCCACCTCGCCGCCAATTGTTCACCCATCGACTTTGACAGGTTTATCCGTTTCCGCAGGCAATCGACAAACCACTACCAAGGTTGCCCACACGTAATAA
TTTTCCGCATATTCCAATTGAAATACCATCCAAGACCAAAGCCAAAGGGACCCGAAAGAGCATTGTCAAATTACGTCAACACAGAGAAATGCACCATCCG
GATGCGAGGCAACCGTCGTATCCGGATTGCATGGCTTTGCATCGCCGCGTCGACGCCGCATAATATGAGCGGCGCGGCAACATGGTGCATGGGCCTGGCT
GGCTGGCTCCATGGCCAGCGTGGCATCCATGGTCGACCGGACCCATGCCATGGAGGTATCATGGCGGCGTGATGCATGCGTGCAGCATCCCGCCACGGGC
AGGTCGATACGTCCCAGGATCGACGATGATGTCCAAGGAAGCCTTGCATTGCGATGTATCTTACGACGAGGCGAAGCGCGCCGTGTCTCTAGCGCCATCC
GCCATTCACGATCATGGTAACATGGCACATGCAGGCGCGTATTGATCTAGTTGTATATACAGAAGTGGTTGCCGTTGCCTACAACTTCATCGAGCGGCAA
ATGGTGAGC