Description :
From Genome Similarity Track
Location :
Scaffold_38:249711- 251291
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_08550JHL20J20.9

Sequence
1580 bases(100 bases per row)
GTACAGCGCGTGGCGGAGCGTACGGTGTACTGAAGCGTTTCAACTTTCAACGACGACCACGAGATCGCATGCGTCGTCCAACGTTGGGCGCCGGAGACGT
CAAGGTAATGACTCGACATGGATAGGCTGCCGATCGCTTCCTGAGATGCATGTACTACATACGATCGATGGATTAGCCGGGCGAGGCGTATGCTGTCGAG
TGGGTCCGCGACGAGGACGTGCACGCGTGCGCACGGTGTGCGACGGCATTTGGCTTCTTTGTGCGCCGCCACCATTGCCGCGTACGTGGTACTAGGTGCG
TGTAGCAGCCATGCCAACGTCCATTTAGGGCTGTGGCAACGTCGTATGCGCAGAGTGCGCCGCGACCCGCCGGGAGGTGTACGGGCTTCTTGGTCTCCAG
CGTGTGTGTGACGCTTGCTTGACCAACGGCGTCTGGGTCGACCCTGTGGCCCGTCGGGCCCTCGAGAAGCTACAGCAGGAAGAGAACAGTCAAGACGACG
AGGCTTCGAGCAGCGACGAGAGCGCTGACGGGTCCAGCAGTGCGTCCAGCAGCTTTGCGGACGAGACGTGGCGCGATGCCATGGACGAGGATGGCGTCTT
CCTCCCGCTTGCGCAGTGGGAGTGTGCGGTCACACGAGTGGGAGGGGCCCGGTACAGTAGTGGCAAGGTGCGTCTTCGTAGCGTTGGTCACAGAGTGTGT
CATGCAAGACATCAGTGAGATCGCACCCATTGAGGACATATCCAGCCTCGAGCCAGCGCTGCCAGCGCGCATCAAGTCGGTCGAAGTGCGTTCGACGCCT
TCCATGCAGCCCGACGCAGAGCCAACAACTGGTGACGCCATCGTCGTCCGACAGCCGAACCCAGATGCCGACAGCAGACGCCACAACGCACCCAAGCAGC
AAGGGGCGGCGGCAAGCGACGACACTGGCTTAATCATTTGGCCTGCGACGTACGAGCCACGTGTAGCGATGCACGACACCCTGTAAATTTTGGCTAGGCG
CGTCGCAGCCTCGCCTTGGTACAGGGGAATTTTCGGCCTTCACCACCATTCTGCAATGAGGAGCGGCGATGAATGATGGTATTCTCGCGTAGGCGGCGCC
ACAATGTCCTCCTCGCCACGCTTGTGCTTGGCCTTTTCTGTTTCCGCCGGACTCGCCCGCCCTTGCTCGTCCGCGTCGCCGCCGTCGCTGCCTACTGGTT
GACGACGACCCCCAGCGACGATCCTAGCGCCACGCCTCGCTAATTGCTCGAAAATGCATGCATGTGCTCGGTTTCTTCTGCGTCGGTTGCCGTTGGGCGG
TTTTGAGCGTGCGTTGGTCCCCCATTTCGAGAAGATCGCCATGGTCAACCCACCGCCGTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGCGAGGCACGCTGCACGTCCGGCGCCGGTCCGCCGAC
ATACCTCTTCCCATTCAACCGTTTTTGCAGCCCGCCAAGCATCTCCGCAACCTATCGCTGTCGTCGCCGCCGAAAGGCCA