Description :
From Genome Similarity Track
Location :
Scaffold_103:2497- 3986
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_103-fgenesh-gene-0.1Mitochondrial-processing peptidase subunit alpha

Sequence
1489 bases(100 bases per row)
GTGTGCGGCTCGCGTTGCTTTGCCGCTCAAAGACAAGCGGCCTCTGTCCCCCCCGGCAGTCTTCCCCCTCCACGATGCTCGCGTCCTCGACCTCCGCGGC
CAAGGCGGCCGCGCGCACCTCGGGCGTGCGCGCGTTCTTCGCCAAGGCCAGCGCCATGCCGGCCGTGACGCTCGACGAGGAATTCCCGGCCGTGCCGGCC
ACGTCGCCGCAGCCGGCGGCGCCTTCCAAGGTGACCAAGTCGGCGGCGGCCTCGGGGCTCACGCTCGCGTCNNNNNNNNNNGGCCGTGGCCACGCTTGCG
GTGCAGCTCAAGGCCGGCTCGCGGTACGAATCGGACGAGACGGCCGGCGTGGCCGCGCTCTTCTCCAAGCTCGCGTTCCGCGCGACCGACTTCCGCTCGG
ACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCGCGAGGCGCTGCGGTA
CTCGATCAGCGTGCTGCCCGACCAGCTCGAGGAGGCCGCGGAGATCCTGGCCGAGACGACGCTGTCCCCCAAGTTCGCGCACTGGGACGTCGACCAGCAG
AAGGCGCTCGTCCGCGCCGAGCTCGAGGCGCTGCAGGCCAACCCGTCGGCTCTGCTGCTCGACAACGTGCACGCCGCCGCGTTCTATGACGACGCGACGC
TCGGCCGCCCCGTGTTCTCGGTGGACAACCTGAACAACCTGAACGCGGACGAGCTGCTGGCGTTCCACCAGCAGTTCGTCAACACGGGCAACGCGGCGCT
CGTGGGGACGGGCGTGAGCCACGACACGCTCACGGACCTGGCGAACCAGTACTTCGGCTCGGTGGCGTCGGGAGCGGCGGTCAAGCCCGAGGCGGCGCAC
TACGTCGGCGGCGAGTCGCGCGTCAAGGCCCCTGGCGCCAAGTTCACGAACGTGGCGCTCGCCTTCCCGGTCGGCGGCCGCTCGACGGCCGAGTACGGCG
CTTCGCACGTGCTGCGCGCGCTGCTGAGCCTGCGCCTGAAGAACAAGAAGGTCTCGACGTTCCTGTCGAGTTACGAGGACGTCGGCCTCGTGGGCTTCTC
GGGCTACGCCAAGCACGAGGAGGCCGGCGAACTCGTCGACTCGTTCATCGCCGAGATCAAGAAGGTGGCGGCCAAGGCGCCGACCAAGGAGGAGCTCGCC
GCCGCCCAGGCGGCCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTTCGACGCCGTCGACAAGTACGGCACGCGCCAGGGCCAGCTCGCGCTCGTGGG
CTACGTGGCGCACACGCCCGCCGACTACCAGCTCAAGACGCCCGCGCAGACGGCCGAGAGCGCGACGGCCAAGGCGGTGCAGGAGCTGGCCAAGAAGGCC
GCGGCATCGGTGCCATCGATCGCGGCCATCGGGAAGCTGAGCGCGGTGCCGCACCTCGACGCGGTCGTCAAGAAGCTCCAGTAGACGAC