Description :
From Genome Similarity Track
Location :
contig_31:249646- 250947
Transcript NameFunction/comments
g6086.t1cobalamin synthesis protein, putative

Sequence
1301 bases(100 bases per row)
CGGCAGCGAGGGGTGATATGAGGGTCATGAAGTGGCTAGTCGAACGATATCCGGGGTTTTACGTAACGTTGGCTGTGGAAGAAGCCGCGAAGAATGGGCA
TCTTGACGTTCTGCAGTGGCTCCACCGACTTGGCCGAGCAGGAGACGCACGTGATCCAAAAGGAGGGAAGAAGAGTCCCCTGCTAGACGTGTTTTGGGGC
TCAAGGGAGTTGTTTTACGCCGGCCAAAACGGACACTTGCACGTTGTGGAGTGGCTGCAGGAGCACACGAACCCGACACCGACGCACATGTTCTTCGTGA
CACTGGAGGAAGCGGCGAAGAACGGAGATTTCGCGATGGTAAAGTGGTTGTGCGAAGTACGCGGAGAGCAGTCGTCGTACGCGTCGGTCCTCGCAGCGAG
TGAGGGCCACTTGAATGTGCTGAAGTGGCTGCGAGGCAACATCTTCAGTCCGTCTCCCTCGGTGTCGATGGATGACGCTGCTGCTAATGGCCACCTTGAT
GTTTTGCAGTGGCTGCAAACGAACGCGGGATACGCTACACCTACAGCGATGAACAAGGCGGCAGGAAATGGACACCTCGCCGTGGTCAAGTGGCTGCATG
ATCACCGCAAAGAAGGATGCACAACGGTAGCAATGGATCTGGCCTCTGCTAACGGGCACCTCGCAGTTGTGCAGTGTCTGCACACGCAGCGACGCGAAGG
ATGCACGAAGGCAGCGATGGATGAGGCGGCAGTTCATGGTCATTTGAGTATCGTCCAGTGGCTGCATCAGACTCGCACAGAAGGGTGCTCCGCGCGAGCA
ATGGACGGAGCCGCGATGAACGGACACTTGGCAGTGGTGAAGTGGCTGCATCAGCATCGGAAAGAGGGCTGCACAACGGCTGCAATGGATGGCGCGGCGG
GAGCAAACCACCTGGATGTAGTACAGTGGCTGCAGCAGAACCGCAAGGAGGGCTGCACGTCGAAAGCTATGGACTCTGCAGCTTGCAATGGCCATCTGAA
GTTGGTGCAGTGGCTTCACGGGCATCGAAAAGAGGGCTGCACAGTCAAGGCGCTGGATCAAGCAGCAGCTTTCGGCCATTTATCGGTAGTACAGTGGCTG
GACGGGAATCGCAAGGAAGGATGCACGTCCAGCGCGATGGACAACGCTGCTGCGGGAAGTCACCTTGACATTGTGAAATGGCTACATGGCAATCGAACGG
AAGGCTGCACAACGGCGGCGATGGATCATGCAGCAGCTAATGGCCATATTGAAGTGGTCCAGTGGTTGCACACGAATCGAAGCGAAGGTTGTACTGGTGC
A