Description :
From Genome Similarity Track
Location :
Scaffold_3:2496166- 2500894
Sequence
4728 bases(100 bases per row)
GTATGAACCCACCCCGTTTCGTGTGATGGAGCGCCTAAAAAAGAGATTTATGGGCAAGACGTATTGAAGTACGCTGAGGGGAGTAAGCTCAGTCGGCTAC
GGCTCGCTCCCAATGGCAATGTGCTAGATCACCTGAGCGAGATGCGTCGGCTGATGGAGACCATTGCTGGAGTCGGGCGTCCTGTGGACGAGTATGTAAA
GCCAGCACTATTGATTGGATCTCTGCCGCGCGAATATGATCATGTTGTACAGGCGTTTCTCGCCAGTCACAACCCCCAAAATGCTGATGGTCCTCCTAAT
TATGAACAACTTGAACTCGCATTGGAGATGGCTTACGACCATCGCCAAGGTCGGAAAGCAGAGGGCGCCAAGGACAATGATGATGAAGAAAAGGCGTTCG
TTGCTGGTGGAGGAAGAGGTCGAGGACGTGGTCGCGGCCGTGGACGTGGTGGTCGATCTGGAGGACACGGGCGTGGTTCCGGTGGTGGACGTGGTTCTGG
TGGTCGCGGGAGCCAAGGTGGTGGACGTGGAGCTGGACGTGGCCAAGCCGGCAGTGGACAAAAGCCAGGTGGTGCTTGTTATCACTGCCATGAAGCAGGG
CATCATGTGTTTGATTGCCCTTTTTTGGCAAGTGACCTCCAGCCGAGGATCGCAGCAGCACCCAAGCTCAGAAGCGCGTGAAGATGTGTGGAGGAAAGAG
TGCTAAGGCTGCTGAAACGAGTAGCTACGCTAATGAAAGTGATGACAGTTATTCTTCAAGTGATGAAAATGAAAAAGCCGGTCGCAGACAAAGCCCATGA
TAACTGGTACCTGGACTCTGGTGCATCGAGTCATATTTCGAACCAGCTCACTGATTTCATGGAGTTCACGCCTCTTAGCGCCCGGATTCGAGTTGGAGGA
AAGAACTCGCTGGGTGTTGAGGGTAGAGGTACTGTGGTTAAGGAACTCGAGACTACTGGTGGGAGGTGCTCACTGACGCTGCGAGGAGTTCGTTATGCTC
CAGAGCTGCAGTGCAGTCTCTACTCTGTGCGACGGCAACTGAACCAATATCTGCCTGAACGTGATCGTGTGAACGTGCACTTTGATGAGGCAGATCGCGC
TGATGTTATCTTACAGGCTGGTGTGACTACCGCTCGAGTTGATTATACCAATCTCTATCGCTTGAAGTTGGAGAGACCCCAAGAGGTAGCCATGGTGGCG
CTACCAGCTCGAGTGAGTAGTTTGGAGCTGTGGCATTCGAGATTGGGGCACCCTGGCAGATACTCGTTTAATGCGCTGTTCTGCCATGATCAGTGGCCGT
TGCCACATATGAACTTGCGTATCCCGGTGGGTTTCAATTGCGAGACCTGTGGGACGGGGAAACTTACGAGGAAGAGCATGAAGAAGTCTCGGACACAGAC
CCGCGAGTGGTTAGTTGGCGCAAAGGTCCATGTGGACGCTTGGGGTCCGTATGTAGAGCACTCCTACGGTGGTAAACGGTACTTTGCCGTGTTCGTTGAT
GATGCGAGTCGGTTTGTCACCGTGTATCTTCTGGAGCATCGTTCGGAAGTGTACCAGAAGTTTGAGGAGTACTATCAACGCGTCAAGACGTAGCAGCATG
TCAGAATGAAAGCGCTAAGGTCAGACAATGCAAAGGAGTTCAAGAAGCTGCAAAGTACGTGTGAGACGAAGTATGGTATGGAGTTTGACAGCAGCATCAA
GCATACTCCGGAGCAAAATGGTGTCGCGGGGAGAATGGTCCGCACCATTACGGAAAGAATGCGATGCATGCTCGTGCACTTCGACCTGCCTGAAGCGATG
TGGGGTGAGGCAGCGATGACAGCTGCATACTCCGTGAATATTATGCCAAGCTCGGTTCGAGGCATGGAGGTACCGTATGCAGTATGGCACCGTCAGACTC
CTGCTTATGAGAAGTTGCGGACGTTCGGCTGCGCCGTCCTGTCGTACATCGACAAGGTGGAGAGACGGAAGATGCAGGCGAAAGCATGGGAGGCGGTCTT
CGTTGGATATTCGCGAGAGAAGCGAGGCTATCGCTTGCTCGATAGCAAGACCAACAAGGCCTTCTACAGCCATACTGTCGTGTTCTATGAGAATAAAGCT
GGTCGATTGCTCATGGACTCGGCATCAACGCCAAGTGCAGCCTCCGGTAAGGAATATTTAGGCGTTGATCGATCAGTAGAGGATGACATTGAGCCAATGC
TGGATGAAATGCATGATGAATCAAATGATGGAGGTAGTTATCGTGATGATGGAGATTGCTGGACTGGTGGGGCCAGCGACTCCAGAGACGGAGGTGATTA
TCGGACTGGTGGGGCTGATGACACCCGATGTGATGACCGACCAGGTGGGGCGGTTGAGCAAGATGTCCGGTCAGGTGGGGCATGTGGGTCCAAGAAGAGA
GGCCCCGGTGGTGATGCCGCAGCGCCTCGACCAAAGAGAGTGCGGTTTGCGGTGTTTGAAAGTGGACGTTCTAGCAAGGTGGCAGAACGAGATGAAGGAC
GTGGAGTGAGCTCTACAGCATCTGGATGTGATCGTTCTAGCAAGGTGGCAGAACGTGATGAGGAACGTGTCAATGGACATGAGGCAGACCACCTGCGAGC
TGAGTGCGTGCCAGACAATTCCAAAAGAAGGAGAAAGAGGAAATGCAGCAGTGGGCGGCATAAGAGACCGGCTGCTGACGAGACGAGGGCCCACCAGGGA
GTCAAGAGGTGGAAGAGGTGGACAGCAGGTCATCGGCTGCTGAGCGGGCCGACTCGAACAGCCAAGTGTCGAGTGATGCTGCGAGTGTGGGGCGTCTATC
AACGCCTCCTTGCACAGTACTTCGTGAGTACACAGGCCCGAGAGGCACTCGCCCTAAAGACCCTCCAGTGACACGGAGCGGTCGGGTAAGTAAACCGCCC
ACGTGGTTCGGTGACTACGACTACATTGGCTACGAAAATACAAATCCAGATGATGATGTGAACTCGTTGCCTGCTGGATGGAGGAAAGCACGAGCTGAGT
TGCAACGTGCTATGGCGAACGAGTTGATCTTTGCATGGTGGGAGGACTGTTGCTGCATGAGTACTGGCGAGTTTGAAGAGCCAGATACTTTCGGTGACGC
TATGGAGAGTGAGCACTCATTGCAATGGAAAAATGCAGCTGATGATGAGTTTGATTCGTTGGTGAAGAACGATACCTGGGAGTTGGTGCCGCGTGAGAAG
CACATGAAAGTGCTGCAGAATCGCTGGATCTTTCGCGTCAAGTATCTAGCGAACGGAGAGATCGAAAGATTCAAAGCGAGGCTCGTGATCAAGGGCTTCA
TGCAGATTTATGGTATCGACTACCTAGAGGTGTACTCACCTGTTGTGAGGCTGGAGACACTGCGTGTTCTCTTGACACTGGCGGCTGTCTGGGATTATGA
AGTGCATCAGATGGATGTCACTACCGCTTTCCTGAATGGGGCGATTGACGTGGAGGTCTATATGGAGCAGCCTGAAGGCTACAAAGTGAAAGGCAAAGAG
GACTGGGTGTGCAGATTGAAGAAGAGCCTGAACGGCTTGAAGCAGGCGCCCAGAGTGTGGTTTCAGCTGTTCAAGTCGTTCTTGGAGGAGCAGGGCTTCA
CGATGCTGCAGTCGGAGGCCTGCGTGGCTGTTAAAGTAATTGATGGGCAGTTGGTCTTCATCCCTCTCTATGTTGATGATCTGATTTTGTTTGCTCCGTC
GATGGAGCTCATCAACAAGATGAAGAAGATGTTCGAGGACCGGTTTGCGATGAAGGATCTCAGGGAGTTACACTACATTCTAGGCTGGGAGATCACGCGG
AACCGGCCCGAGAGAACGATGTTCATTGGTCAGCAGAAGTATGCCGAGACCGTGCTCAAGCGGTTCAACATGCAGGACTGCAATGGCTGCAAGACGCCGA
GCACGGCGGATCTGAAGCTGAGCAAGGCCATGTGTCCGACCGAAAACGACGAAAGGCAACTGATGAGATCGAAGCCATATCGTGCTGTGGTTGACAGCCT
GATGTACCTGATGCTCGGTACCCGGCCCGATCTGGCCTACCTAGTTAGAGAGTGCAGTCAGTTCTCGGAAAACTCAGGTCTGTTGCATTGGAGAGCTGCA
AAACGTGGATTGCGCTACCTGAAGGACACAGCGGACTGGGGGATCCAGCTTGGTGGCCTAGCGTGGTCAGATCAAAAGCTGGATGATCATCTGAGAGCAT
ACGCAGATGCGGATTTTGCAAATCGAGTTGATGATCGAAAGTCTGCTGCAGGCTACGTGACTCAATTTTGTGGGAGCATCATTTCGTGGAGCAGCCAGAC
GGTGAAGCCCGTCGCGCTACACACGACCGAGACTCTTAGTCTACAGGTGCAGGAGGTGGTGCGCTTGCGCCAAATGCTGAAGGAGCTGCAGGTGCAGCAA
ATTCAGCAATCCCAAGTCTTTGTGGACAATGAAAGTGCGAAGAAGCTTGCCAGCAACCCTGTATTTCACTCCCGGACCAAGCACATCGATGTGCGCCACC
ACTTCGTGCGTGAGCGCATCGATTTGAAGGAAATTGACGTGCGTCGGGTGCCAGGAGTTGATAACGTGGCCGATGCTTTTACAAAGCCATTGGCACGTCC
GGCATTTGAAAAACACAGAGCTGCAATGGGATTATTGCCAAGGGCAAGATTTGGAGATGCAAGTTGATGGGAATCCGTAGGTGGGGCTGTTGCGGATTGT
ACTGATCCCCACTATACTACTTGCAGTT