Description :
From Genome Similarity Track
Location :
Scaffold_212:24946- 29970
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_212-fgenesh-gene-0.12Conserved gene of unknown function
Pytir_DAOMBR486maker-pir_contig_212-snap-gene-0.22Conserved gene of unknown function

Sequence
5024 bases(100 bases per row)
TCCCTCGCAGTGGCGACCTTTTCCAAAGACGAACGGATCCTGCGCGTGGTGGCGGAAGCCAAATGGAATGTACTTCTCCTTGGCCCGCGACTTGCGCTTC
GATGGTCGCAGCAAGTGGCACTTGAACGCGACTTCCTTCATATCCGGCTCGTGTTCTCGAAACGCGCGATGCACGTTCACGACGTAGAGCACGCAGGAGC
CAAAGAGAAGACAGTCACCTCGGCCGATCCGCGTCGGCTGCTGGAGCGACACACGCGTCTTCTTTTTCGGGTTGTCTTCGAACGACAGGTCCTGGAGCAC
GAAGAAACAGCCGTCAAAAGTGATGCGTGCGTGCACGGGATGCACGCCAGGCGCCGAGACCTGGATGTCACACGCTGGAGAAGAGCCTATAAGGTAGGGG
TCTTTGCCAGTGAGCTGCAGCTCCTTGCTGACCTGCTGGTCGTCTACGAGGGTGGAAATGCTGATACTAACTGGGATCTGCTCCACGTAGGGACTCAGTT
TCTTCTTCTTTTTGCGTTTATATCGATTCCCGACGACAGGAGAGCCGTCGAAAGCGTCCAGTACTTCACCAAAGCGGACGCGTCGAGATTTGGACACGTT
TTCGCCACTGTCGCAGCTTCCGTTCTCGTTGTTGCCTCCTGATAAATCGGACAAGCGGCGCTCCAGATGAAGCTCCAGGTCGGAGCACTCACGTTTCTTT
GGTGCAGTGCACACTTCGTGCACGATCACTTTCGCATTCTGCCCGAGCATAAACGTGTCTCCATTGCGTAAGCGAAACCCGTCTCTCTGTGGGTGGTGTC
GGTTGATCGTGGTCAGGCAGAGAAACGACCCACTCGAGCTGTTGTGGTCGCGGATCAAATAGTCGTCGCCATCGATCATTATCTCTGCGTGGACCGGATC
CATGCTCGCGTCCTTCGTGGAGACGAGGATGTGCTCTCCGTTATCGCGACCGATGTACCCAGGACTCAGAAACCACGACTTCTTGGCTCGGTTCTGTATT
TTCGCCGCCATCAAGCACAGCTCTTCGCACGAGCGCAGTCGGCGCTTCTCCTTGTGTGCGGGTGATAATGCACCAGCACCAGCGACGCTGACTGAATTAG
CCCTGCGGAAGAGTGAGCGGAAATCAAACTCTGGCGTGTGGTTGAGGAAAAGCAGCGTTTCAGCCGCATTTTCATCCTCATCCTCGGCAGTAGCGATGGT
GGCAGGCGCGACGCTTCTCCGTTTCTGCCAGAAATCAAACTTGGTCGACTTGGATGATGCTGATGTCGTTCTCGAACCGGTGGAATTTAACCGCGCGTCC
GTGGCAGTCAGGTCTTCAGATCCAGTCGACGACGTGCGCTGTGAATGCTGCTCATCTGAGCTCATTACCGACCCTCGGAGCTGGTGCGCGATGGCTCCTT
TGCAGCGGAGATAGTTCAGGGGAAGCAAGGGAAGTGTGCGGCGCGCACAGGCATCAAGGGGCTGTCTCACGCTCGCAGATAACAATGAACGAACGAACGA
ACGCACGAACCAACATCCAGTCGTCCATCAGCTCTCTCGTCAACGAGGGAGCAGCAGCCGCGGAGGTTAAGAATAGCTGGTGCGCGCGAGCCAGGACGCC
ACAAAAAAAGCAAAACGATGCCGATGAGGCATGAGCACCACCGACTGCTTTGGGCGACAAAGGCAGAGAATCGGATATTTATATCTGCTTCGTGCTCATT
TATAGGCAGGCGATCGCAATTAAGACCGCGCTGCTGTCTCGCAGTAGTTTCTTTGAACTCGGATTGTTGCGATCCAATTGAATAGGGGAAGCCCCACCCA
CCCTCTTAAGCACGAGACTATTCGGGTTATTAAATCCACCAGCTCTGGTCAACCGCTGTTGCTTGTTTCAACCTAGATGAATTACTCATCATTGGATGGA
GTACACGTCATGAAATTGGCGAGTGCGCTCATCGATTTATTTCCAAGTACAGTATGGTATGTCGTCGTCACAACCCTCTCGTGACGACTCCTGATGTGGT
CCTCATCCATAACGATGATAAATGGTGGTGCACTTAATTACTCAATTCGTGCGCGGAGATGTATGTAGCCATGTGTCATGTATGCAGCCATCTCAAGTAT
TAACCAATCACAGCCTCTCGCGACTGTCCACTACCCAATCAAACGTCCTTAAAAAAGAACGCTCCTGTCACAGGTGACTTCCACCAATCAGAGACCAGCA
TTCAGCGAACATTTTTGATGTATCCATGTGTCCATTTTCCAAGCAGCACGTGTGTTTGTTTGCCTACTCGTCGCCGAACATACGCGCACTTTCCACTCTC
AAGTCGCCGGTGAATACGCAGCTGCTGAAGATGGGGAAAATTTACAGACAAATAGACCAACAACCAGACAGGTACGCGGACAGAGTGGACACACTGAGTG
ATATCACCGTCTTGCTGAGTTGACGCGTGCGTGAATGGCTCTACTGTACATGTTCCAAGTGAGCCATGTGCCAACTCAGGGGATCCGAAGTGTCAGCGCA
GATCCAGATCTTCATTCCTCAACCTGCCTTCCAGCACTCAAGCATCAACCATCCACTCACTATCCATCCTTCCCAATTATCCAGTTCTAGTACTCCCACT
CCATCCACCAACCACCCATGGGCAACAAAGTGATCACCGGCGTGTGCACGCGCGACGACAGCCTCGACGTCGGTGACCTCTCGGGCGCGAACTTTGACTT
CATCTCAGTCGCGATGCGCAGCGGTTCGACCTGCGCGACCCCGAGCTCCCGCGCATTCGTGCCAGCCTCCAAGATGGTGGTCGCCGTCGTGCCAGTCGAC
TTCAGNNNNNNNNNNNNNNNNNNNNNGTCTCAACTTAAGTCACCACCACAGCAGTTCCTCCCCCTTCGACAAGGTAAGTACGAAGCCAGCGACACGCCAG
ACCTCCTCGACCACCATCACTACTGCCAGCTCTCCGACTCCAACTCCAGCCAGCGACGACGAGCCTGAACTGAGCTTCAATGACCGCCTCAACAAGCTCA
CGTGGGACCCCGAGGACTTTGCGCTCCCGACTCGCGCCATCAAGCACCAGAATGCCGTCTGTACTTCAGAAGCTTCTATCTCCAAGCCGATGTCAATGTG
GAGCGCCACCCGCCAGCCCGCGACGACCTCGCCAGAACCCGCGCAACGGAAGTGCAAGACGCCGTTCAGATGGCTCTCGCGCACCTTCAGTAGCTACAAG
AGCTCCGCCGCGCTGAAGAAGCAAGCCGAGGATCTCCAGAAGAAGACGAGACAGCAGCAGCAGCAGCAAGACGACCAAGACAAGCAGCAACAGCAGGAGA
CAACGTTCAAGACCCGAGCCTCCTCGATTAAGACCCAAGCGATGACCAAGACGATTATCAATCACGACCAAGATCAAGAACCACCAGTTGTGCAAAAGAT
GGAGCAGCTCGCACACGACGACCATATCAGTTGCGAAGGCCCAATCTCTGATACCGAGAGTGAGTCCAGCGCTACGGAGCTCTCGTTCCCCTGCGGTGAT
GTCTCCCCCTCCTCCCCCTCGACTATGTTCGCCATGGCGTTCAGCTTCTTCCGCAAAGAGCCGTTCAGCGACTCGACCGGCTTGTGCGAGACCTTTGACA
ACGAACACGACGACAGTGACGACGACCACGTCTCGCTCGTCTACTTATCTTCCTCAGTGAACACCTCGACCGTCAAGATGCGCGGCTATCTGTGCGACTG
CAGCAGCTGCCCAGCGTACCGCGCGATTGAGAGAGAGGTGACGACTTCCACTTGCTGGATGAACGAGTGCGAGCGACAGAGCATCTGCCGCATCCTGCAG
GCGTATTCGACCTACAACGAAGCCGTCGGGTTCTCGAAATCCATGGTCGCGTACGCGGAAGAATGTCTACTGGTGTTCCGTGGTGACGAAAATGCGGCGT
TCAACGCATTCGTGCGTCTTGGTCAGGAGAAATGGGAAAAGTGAGTGAATTGCCGGTCATCCAATCAAGATCAGCCAAACAACACAAGCAACGCGATGAA
CGCAACCTCCGAGCTGTTCGCTACATCTTTGGATCGTGAATGTGCTGACGGTGGAGTGACTTTGAAGATCTCCGTCTTCTGCGGGGTACTACAGCGGCAT
GTAGGCTGGGGCGAAAAAAGGTGGTAGCTGCGGCTAGTAGCGCGCTTCTCTCATCACGAAAGCGCACGAAAGCTCAGCGTTAGCGAGCTGCACGAGGGAT
CCCCATTACGATTCCTCAATGTGTGCTCCTAACCACTCATTTTCATCCCTAGTGTTCATGTCGCTGTGTGTGCTCTGGACAAGACTGAAGGCTCTTCAGA
GTACTCTGTCGCTGGTGTGTTTGGGGTCCAAATGCTAGCTCCCATCACTCCTCCCGATTTGAACTTGAAAGTATTTGCTCAGTACTGCCCTCATCACGGC
AAGGAACCTGCAAGGACTTCTGTCCAGAGAAACCCGCTTGTCCACTGGAGTATATGCGAATCTGCGATCCAGAGCCCTCATCATGGCTTCGGTTCGCATC
GATCGCCCGCACTCTTGACCAGGTTTTGAGTTGCTGCTTGGCACTTCAACTACCACCAGCACCAACCTTCTCAGCCTCCAAGGTACAAGCTTCCAAGCAG
CATTCGCAGCGGACCCAGCCCTTCGACTCGTTCGGCATCGTGCCATCCAACCACCAACCACCATGCCCACTACTAGTAGCATATTTATCGTAACCTATTT
AATATGCCGATGCACATGTTGTTTTGATTCATCAACGTTTGTTCAACCTGCTTCTTCAATCAATCAATTGGTTACTCTATGCGCAGCTCTTAAGAACTGT
CGTTTGGGGTGGCGCGGCCGCGTTGACATCTAACAACATTCTTCTCAATTCCATGGTTTGACAGCAGAACATCCTCGTCGCTCCGCCAACACCAGCGCAC
TAGCACTGCCACCGCCACTCACTACTATCTCCAGCATCAGCACCCTCTCAGCTCCACCAGCACCAGCGCACGCACTGCCCAGGCGGGTACACAATGTTCA
AAGATGGCTCCATTTTTTTTGTTA