Description :
From Genome Similarity Track
Location :
Scaffold_2:249458- 251731
Transcript NameFunction/comments
Phymu_g171heat shock cognate 70 kDa protein

Sequence
2273 bases(100 bases per row)
TTGAgcatgcgcttcttgtcctcgaGCCAGTCGCGGGCGTCACGGATGGCGCTCTCCACGTTCGTGTCGCCCTTCTCGCGAGCCATCTCAATGGCGCGGT
AGATGAACTGCTCCAGGTCGTTACGGGCCTCGATGCGGCGGAGCatctcggcgtcgtccttcttgaacttgtcgGCCTCGGCAACCATACGGTCGATGTC
CTCCTGGCTCAGACGGCCGCGGTTGTTCGAGATGGTCGTCTCGGCCTTGGCGCCGGTCTTCTTGTCGCGGGCGGACACGTTCAGGATGCCATTGGCGTCG
ATCTCGAACGTCACCTCCACCTGCGGCTCGCCACGCTTGGCGCGCTCCAGGCTCGAGATGTTGAACTCGCCCAACTTGTTGTTCGACTCCACGCAGGCAC
GCTCGCCCTCGTAGATGCACACGTCCACAGACGTCTGGTAGTCCTCCTCCGTAGTGTACACACGGGTCTTGCGCACGGGGATGGCCGTGTTGCGCTTGAT
CAGCACCGACATGACCTTGCCCACGGTCTCAATACCCAGGGACAGAGGCGTGacatccaccagcagcagcgagttggtGGCGTCGTTACGGATGCCGTCC
AGGATGGCGCCCTGCACGGCAGCACCGTACGCGACGGCCTCGTCGGGGTTGATGGACTTGGACAGCTCCTTGCCGCCGAACAGAGTGGACAGCATCGTCT
GCACCTTGGGGATACGCGTGGAACCGCcgaccagcaccagctccgtcacgtcctcgggcttcatcttggcgtcctccagtACCTTCAGCACGGTCTCCTC
GCAACgcttgaacagctcctcgTTCAGCGACTCGAACTTGGCACGGGTCACGGTGGACGAGAAGTCCACGCCCTCGAACAGGGAGTCCACCTCCACCGAA
GCGGAAGTCGTGGTCGACAGCATACGCTTGGCCGACTCACAGGCCGTACGCAGACGGCGCATGGCACGGGGCGAGCCGGACGGGTCCAGGTTGCGgttct
tgcgcttgaacTCCGTCAGCAGGTGCTCCACCATGTTGTTGTCGAAGTCCTCACCACCCAGGTGCGTGTCACCGCCCGTCGACTTGACCTCGAAGATGCC
GTTCTCAATGGACAGGATCGACACATCGAAGGTACCGCCACCCAGGTCGAAGATCAGCACGTTGCAAGCCTTGCCGTCCGTGCCGGCGTTCGTGTCCAGA
CCGTACGCGAGGGCAGCAGCCGTCGGCTCGTTGATGATACGCTTGACGTCCAGGCCAGCGATGGAACCGGCGTCCTTCGTGgactgacgctgctggtcgt
tGAAGTAGGCGGGCACCGTCACCACAGCCTGCGAGATGCTCTGGCCCAGGAAGGCTTCGGCGGTCTCCTTCAtgcgcagcagcaccatggacgagatctc
cTCGGGggtgaagctcttcttctcgttcttgaacTCGACCTCAATCAGgaccttgtcgtcgtcgccctcCTTAATCGTGAACGGGAAGTGCGCCGCGTCC
TTCTTCACGACTTCGTCGCTGAACGAGCGGCCGATGATACGCTTGGCGTCGAACACCGTGTTGGTGGCGTTACCGGCGGCCTGGATCTTGGCGGCCTCAC
CGATGAGACGCTCGCTCTCGTTGAAGGCCACCCACGACGGGGTCGTGCGGTTACCCTCGCTGTTGGCAATGATCTCCACCTGGCCGTCCTTCCAGACACC
CACGCACGAGTACGTCGTACCCAGATCAATACCGATGACCTCCGAGAAGCCCTTCTCGGCGCGCTTGGCGCgctcctcgcgctccttGCGGGCcttgttg
atcttctcctcgatctccatgCGCTTCATCTTGCGCGTGGCCTCGTCCATCTCGACGCCCgagatctcctcgtcctgcacCTGCTGAGCGGCCTGCGCCT
GGGTCAGACCAGCCTGCAGGGCCTTGTTGCCCTTCTCCACGGTCAGACCCTGCGTGTACGCAGTGATGGCCTTGGCGTAGTTCTTGATGTAGAAGTGGGC
AGCTCCGAGACGAGCGTAACCCTTGGCGAACTTGCCGTCCAGGTCAATGCACGCCTTGGCGTCCTGCATGGCGGGCGTGGCCTGGCCAGCGGACAGGTAC
GCGGCCGAACGGTTCGAGTAGTAGATGACGTTCGTCGGCTCGTACGCGATGGCCGTCGTGAACTCCTTGATGGCCGTGGCGTGGTCGCCCGAGGCGAAGG
CGGCGTTTCCGCGCTCCTTGGCCTCAGCGCCGAGCTTGGCACGCTCCTCGGGGGCGACGCCGGCGTACACGTC