Description :
From Genome Similarity Track
Location :
contig_33:249458- 251313
Transcript NameFunction/comments
g6480.t1hypothetical protein PHYSODRAFT_518366

Sequence
1855 bases(100 bases per row)
ATCCAGGAGATCACGATGGAGGAGAACGGAGGCCACCCCGTCATCTACGGCATTGACTCCGTCCACGGTGCCAACTACGTGGACGGATCTGTGCTGTTTC
CGCAGCAGATCAACAGCGGCGCGAGTTTCAACCCCGACCTCGTCCACGAGGTGGGCCGCATCACTGCTCGTGACACTGGGGCCGCTGGAATCCCGTGGAT
CTTCGGGCCTATCCTCGACATCTCGCAGAACTCGCTCTGGTCTCGCACCTACGAGACGTTCGGCGAAGATCCGCACTTGTCCTCCGTCATGGGCGCCGCT
CTTGTCCGCGGCCTCCAGAGCCACAACCAGACCGCTGCCTGCATCAAGCATTTCATCGGCTATTCCAAGACACCCAGTGGCCACGATAGAGACAACGTCA
TCATGGGCGACTTCGACCTGCTCAACTACTTCCTGCCCCCGTTCAAGGCTGCGATGGAAGCCGGCGCGCTGTCCACCATGGAGAACTACATCTCTTTGAA
CGGCGACCCCGTGGTCTCTAGCTCCAGAATCCTTAACGACCTTCTACGATCGGACCTGTCCTTCAACGGGGTCCTGCTGTCCGACTGGAATGAAATTTAC
AACCTCCACGACTTCCACCGCGTCTCCAGCACCCGCGAGGAGGCCGTGGCCACGTCTCTCAAGCAGACGTCGATCGACATGAGTATGGTGGCGACGGACA
CGGATTTCATTGAGTACGGTCTCAACATGCTCAAGGAGAACCCGGACCAGGAAGCTCGACTGCGCAAGTCTGCTAAACGCGTCGTCAAACTGAAGCTTCA
GCTTGGACTATACGACAACCCGGTGCCTGGCAAGGAGAACGTGGCGATGGTGGGTAACGACAAGGACAAGGAGACTGCACTGGAGATGGCGCGTGAGTCC
ATCGTGTTGCTGCAGAACAAGAACGACACCTTGCCACTACCAAAGACCGCTTCCGTCTTCCTCACAGGCCACTCGGCAGACAACGTGGGGTACCAGTGCG
GTGGCTGGACCTTCATCTGGCAGGGCTACTCCGGTAACGACATGTTTAACAACGGCATTTCGATTCGCAAGGGCCTGGAGAACCTTGTCGGCAACGACTC
CTTCACGTACTTTAACGGTCTGCTCGCGAACGGGTCGATTTCGGATGCTGCTCTTGCAAAGGCTGTCGAGCTTGCCGGCCAACACGAGTACACGATCGCA
GCCATTGGTGAGTCGCAGTACACGGAGAAGCCCGGTGACATCGACGACCCTGCACTTCCTGAAGGCCAAGAGAAGTTCATCGAAGCACTCGCTGCCACGG
GCACCAAGGTGATCGTGGTGCTCATTGAGGGCCGCCCGCGTCTTCTTGGCTCGATCCCCGACCACGCCGTCGCCATCATCGACGGAATGCTGCCGTGTGA
ACTCGGTGGCCAAGCCATCGCAGAGATCATCTACGGAGACGTGAACCCGAGCGGCAAGCTGCCCATCACGTACCCGAAGGACCCGGCCAACATCGCCATC
CCGTACAACCACCGCGTGACCACGCGGTGCATGTGGGACAACTGCTGGATGCAATGGGACTTCGGCGCCGGCCTCAGCTACACGAAGTTCAACTACTCGT
CCGTGACGCTAGACAAGACGACCATCACCAACGCGGACGACACGCTGACCGCCACGGTGACCGTCACGAACGTCGGCTCGCGCACGGGCAAGGAGACGGT
CATGCTGTTCCTGATCCAGCCGTTCCGCAAGATTTCGGTGCCGGAGATGAAGATGCTCAAGAAGTTCAAAAAGATCGAGCTGCAGGCGGGCGAGTCCACG
GACGTGTCGTTCTCACTGTCGGCGGAGGACTGGGGCGTGTACGAGCCGCAAATCG