Description :
From Genome Similarity Track
Location :
Scaffold_1296:2494- 11280
Transcript NameFunction/comments
Phypl_g13028hypothetical protein
Phypl_g13029hypothetical protein

Sequence
8786 bases(100 bases per row)
GGACGTTGTGCCATGGCCGTCACGCCTCCTTCGTCACCTCAGCGTCCGTGTGCTGACTGTCGATCTGCTGTTCCGCACATGGAGCTACCCTGTCTTCTGG
ATCTTTCCACAGCGTGATCCGGCACCCCCTCGGTCGACTTGGTATCCGGCATTGATTACTGGGGGTCACATACGAGCTCTCTACGCTGCCCGCCCGTGGC
GCGTGCTGGATAACCCGATCACGCCCCGATCTTTCGAGTTGATCGGCTGGTTCGAGACTTTCGTTCAGCTATACATTGCCTTCGAGGATGAGATTCGTCA
GGCATTCTGGGAATCGACTCACGCCTTCCCGATTACGAAGGAGATGCGAGACACGAACCCCTTTTTCCCTTCCTTCTATCTGGAGCGGAAACAGCGCCGT
TATCGGGCCGGACCCCGGTTGAAAACTCTTCTTCGTTTTGTACTACGCGGAGTGATGGTGGGTCACTGCGATGTGGATCTGTTCCTGGACCCGTTCCTCC
TCCACTTCCCGCGTAAGATCGAGAACGGCATCTGGCGTCCCGGGCTTGGTATGAATCGAGCTCCCGCTGACCTACGGACGGCCCTGACGGCCATCGACTT
GGCTGAACCTTGGCGTAACAAGTTTCGCGACCACCCTGCTGTCCATCCCGCTCTACGGATCTCCCGGCTGGAAGGTAAGTTCCAATCCGTCGCAGGTGGC
GACTGAGTCTCTTCGATCTCGCGGACAGCAGGTGAGCCGTTTAGCCAGAGTCAATAAACTGAAATCAATTTCCCTTCTTATTGGAGGTCCGGCTGGACCT
GGATCTGGATGGCTCGGGCCGTCCGATCCACACTCATGCTTCACAAACAAACCTTCCTCCTCAGTGTGCGGCCACCCCGCGCACTCGTCACCCATTCGCT
CCTCCTTCGCAGTAGCCAACCTACTGCGAAGAGTCGCCTGCATCCTCTTCATGGGACTGCATCATTTCGAACCGGTTTCGGCTCACGCGGTTCCGCTCGA
ACTCGCAAAGCAGAGCACCACAGTTCAAGTCGGCCTCATCCACCCACGTCGGCTCGTCGTACCCCTTCCAGTATACTTGAAAATCCCGATGCACTCGCCC
GTATCGCGTTCTCCGTCCCGACCGTACGTCCACGATCCGCTCGACTTCGAACTCGTTTTCGTCTAACGCTCTCTCCCAGCTGTCTTCGGGTAGGAGCGCC
TCATCAAAATCGATGCGATCCGGTTCGTCCACCGTGAGAGGCGTATCAGGCCGATCAGGAAAGCTCCTGACtagcttcagcttggacacGTGGACAATAG
GAAAGATCCTATACTCCGTACCTGCTCCCTCCAACCGAGCGGCATATCGATCCACCATCCCCGCTACGCGGAACGGCCCATGCCACAtgtgcgccagctt
cttcgcgtagCCTTCTTTCACTCGATCCAAGAACAACCAGACCTGCGATCCGGCCCTGATCTCATGCGGCCGCAGCTCCTCATTGTGCTGGTCGGCCCGG
TCTTGGATCCCTTCTCGGAGACGCTTGCTGACCTGCTCACGAGCTCGCTAGTACTGCACATGGATGTGGTACCGCCATCAGCGCGGATCTGGATCGCGGC
GACGCGTGCTGCCtagcggcagcgacgcctcCAGTGTCGACCTCGGGTCCCAGCCATGGACCAAGTAGAACGGGGTGTCGCCACAGACTCGATCCTGAGC
GGTGTTCAATGCGAACGTGAGACGCTCCGCGTGCTCGTCCCAGTCTTTCTGGTCGACATCGGACACGTACATCTTGAGCGCCCGCGTTAGTGTCTGCACC
ATGCGTTCCGCCGTGCCGTTAGCCTGCGGTCGAtgcgtcatcgtcgctctCTGCCGCTGGCCCGCTATACGGTTGAAAGCCCGGAAAAACTCGGACATAA
AACCGGGTTCACGATCATGCCGGATTGCCTCACTCGCTCCAAAGCGCCGAAACACACACTCCTCATAGTTCTCCGCGATCGTCTGCGCAgtgcgcgacgc
gctcgccttCACGATCACGTAGCCGGTGAACAAGTCAACCCAGATCAAGATCTCTGTGTTCCCCTTGAACGActtcggcagcggcgggATGTGGTCCATC
GCGACAATCTGAAACGGGTACGTGGCTCGCATGTTCCTCGGCGATTCCTCCCGGATAAGTGGTCGCCCCTTCCCAGCCTCACAATCAACGCATTCTCCCA
CAAACCGTTGGACACTCCGATATAAACCTCTCCAGTGAAAGTGCTTCCTGGTCCACTGGTAAGTCCTCCCGATACCTTGGTGCCCCCTTCCAGGCTTGCA
TGGTAGTGATGGAGGAAGTCTTGTTGCAACGTGTCAGGTACCACCAGCCCCGCGACCAAGTCCCGATCTCCATCAGCTTGCCTGGCTACTGGACagaaga
acagcagctcgttctcgtccagatCGTAGTCGTCTTCAAGCTTGGCGCAGGACTTGGCTTCAGCGGTGCTAAGATCAGCTACGTCGCCCCGAAGGTACTG
CCTTCAAGTCTGCGATCCACTTCTCCTCGTTCTGAGCTTGAACAATGCGCCCACCTCTCATGCGTTGTACGATTTTTTCTTGCAAGACTTCGGGCTGCTG
AGGTCATCGCCTTGCCGATCTAGTAACAGCAGTCACGCGGACAACCATGTCAACCGCCTTTGGCCTCAACAGCTCGTCCAGTCTGTTGAGCGTGATCAAG
TCCTGACGATCTTCCTCCGAGGTAACCACTACACCTGCTTGACCCTGTAACGCGGCACTTGCTAGCCGATCGGCGCTCTGATTCCAGTCGCGCCTCGTGC
ATGTGCAAGAGCTCGTGCCTCGGCCACGACCTAAGTTTCTCTAGTGCCTTCTGCCGCAGCAGTTGCAGACCAGGTGCCTTGCAGTCGATTTCGCCACGCA
TCTGCCTGATCACCAAGTTGGAGGCTCCACAAATGATCAGTCGCCCCCTGTCCAGATCGGACAGGAGATcgaagcacagcagcaaccctCGGTACTCGTC
TTCGTTGACCGTCAGGTCAGCTATATCTTCCGACGCTGCGGTGAGGATCGTCCAGTTGGGGAGCTTCCACACGATCGCACTGTAAGCTCCGGCCTTTCGC
TTGACGCTCGCCGAACCATCGAAGCTGACCACTAGCAAGCTCTCATCCTGATCGACCGTCGGTGGCAATATTGTCACTGATTGGCGAGGTTGTTTCTTCG
GCGCGACCGCGATCAACATCTCATTGACTTCCGATCGAGGCGTGATACTTGCAGCGATCGTGCCAAGGATttcgtcctcgcccttcGTACACTTTCGGAT
CTCAAGTGTCCATTCAGAAAGGAGCGCAGCCCAACGACCAAGCCTACCGTCCAATCCAGATTATTTCGCCAACCACACCAGCGTCGAGTGGCGAGTCAAC
ACCTTGATCGACCGCGTTACGAGCAACGTGTAGCAGACGTTCAGGACTCGGAGGAGGGCTAACACCTCTTTGTTGACCATCCCGTAGTTGATCTCGTTCC
CCCTCAAGGTACGACTTGTGAAAGTCACCGGCCAGTACACCCCGTCGTGTTCCTGCACTAGCGCCGCGGATATCGCCCATTTACTGGCGTATACTACCAC
GACTGGGGTCCGATCCAGATCAAAGTGACGAAGTATCGATGTGGACGCgatcttcgccttcagcaaAGTGAACGCGACCGTGGCTCTCACCCAGCGATCG
TCCTCCTCAGGTTGCAACGCAGCGCCCCCTGTCTCTCGGCTTCCAGTGACCACCTCGTCTCGTCCGTGGAATTCGTGGAAATCCACCTCCCGCAGCTCGT
ACAAGATAGTAGCGTAGATCGCGAAGTCCTCTATGAAGCGGCTGTAGTAGTTCAAGCTGCCAAGAAAGACTGCATCGATCGTAGCGTACGCGGGAACGGG
AGATTGACCAAGGCATCGAGATCCTTAGGATGGGCCTCCAGTCCTCCCGCCGACACCTGATGCCCCAGGTAGTCGACCTTCCGGTGTCCCCAGACACTCT
CGACCACACTGACCGAGAGGTTCCACTACTCGCAAGCGTTCAACAGGCCATCTACCTTTGCGCAAAGGGTGTCCCAAGATTCGGCCGTCACCaagatgtc
gtcgatgtacGATCGTCGTCCCAGGATGGACGGCTTCAGATCGGTGTCAGGTTCGCCACTCTCGAAGACGTCACTCGTCTCTGTCAAGTCTGGACCCGCG
CTGATCTTCAGGTGTCCGTACAGCGCATTGTCAATGAGCCGCTGATTGATCTGAGGTGCGTTCTTCAATCCGAATGGCATACGCAGCCACTCAAAAAGCC
CGAATGGGGTGATGAACGCTGAGATCATCCGCGCTCGCTCGGTCATGGTGACCACCCAGAATCCACTCGCCATGTCAAGAGAGCAGTACCAAAGCATCTT
GTCCAAGTCTTCCAGAAGATTGTTGATCAGCGGCATCGGATACACCATCAAGCGCGTCAGGCCGTTGACGACTCTGTAATCGATGCAGAGTCGAATATCA
acgccgtccttcttgatgatGATCACGATCGAGGATGCCCACGATGAGGTCGAGTGCTTGGTGATCCTAGCCGACAGCAGGTCCTTGATGAGCGCAGCCA
ACTTCTCTCGAAATTATGGAGCAACCGGTCGCACGCGCTGGGCTACTGGAGTGGCACCAccgacgtcgatgtcgcacactgcaccgcgtgctgcaggtgg
cagGGCATTCCCTTTGCCGATCAGCAGGTGCTGACATCTCCAGATGACCCGTCGCAGCCGATCGATCTCTTCCGGGGTATTCAGATCGGGATCGCCAACC
TGACTATCTTCTATCGTTACCTCTTCGGTCGAAGCCGCTACCTCGGGCAAGATGACCAAGTTCCGTTCGAGATCTTCTGGGAACAAGCCGCCGCCCTCAT
GGTAGCAGACCTGTTCTGCCTTAGCTTCAGCCGAGCTCGACTCCAGGGAAGTATCGACTTCGGTCTTCGGCAGATCTTGTCTTGACTCGACCGGTCCCTC
TTTCTGGATCGGTGCAGGCTCCTGGGCGACTCGATCTTCGTCCAGTTCTTCACGCTTCACCTCGGATTTCGGTAGACCTTCCCGTGTTCCTTCGCAGGGC
GATGGTAAGGCTGTTGCTACGGCCACCACTGGTTTAGGAAGCCCATCCGACCGACTCAGAAttcgcgtcggcgtcggatATTGAGGCCGATCCACCAGCG
GTTCCACTGACTCTTCTTCGGGTCCGGGTTCCTCCTGTCGCTCAGTGGTAgcctcgagcgcgaggtTCTGCCACTCAGCGTATCTGCACGATCCGACTGA
AACAAAACCTGGCATACGAGGTACAGCGTCTGGGGTTAAGCAAATTCCTAGCCGTGCGTGCCGATCGAGCACTAACTTCTCTTCGCTCACGGTTGTGATC
CGCAGATACCTCGTTCTACCCAGACCCCTGATAGCGGTCGGCACCCATCTTGTGCCCCGTGTGATCCAGAGCTTTGCGCTAGCCGATCTGCCGTATCGGA
TCGGGACCTCCACGGAATCGGCGACTGGCACTTCGAGATCTTGGTCAAGCGTGACATGCCGGACCGCAGCGCCGTATAGCGGACGCCGTCCTAGCAACTG
AATCCGCACCTCATCAGGGAGACAGAACGTTCCATCTACCAGATCGAGGCGGACTCCGGCTGGTACCATGAAGTCCATGCCGAGTATCGCTTCCTGCCCC
GACTGATTGCCAACCCAAGTGTCGAAGAAGTACACCATCGATCTAGCCAACGTGACCTTGATCGTGGTACGTCCAACCGTCATGTATGTGTTCTCTCCGA
TCCCGATGCATTCTTATCTCTGACTTTCGTCTATGACACACCCAACCTTACGAGCAAAGGTGGTGTCTATGATTGAGACTTCAGCGCCAGTGTCGAAGAG
CAATGTGGCCTTCTCATTGTTCACCTTGGCGACGGCTTTGGCTTGCTTGAACCTCTTCCCAGGAGCATGATACTTCCAGTACCCTCGTGATTCCCCGGGC
TGGAGATCAGGAAGCGTCCCGCCCCCAGATCGCCAAGCCGTCTTGACCTGTCGAATGTTTGGGTCTCCCGACGTGTCTTCCTTCGTGACAGGGGCGAACC
ACTGCTCCGGACCCCGTTGCTTCCAGTAACATCGCTGTTCCCCGAGTCGGAGATCCAAGGCTGCCTTGACATCGGACCTGGAGAACTCATCATCCAGCCG
CAGGCTTGAGATCGCCACAGTACGTTTNGCATGCTTGCTGGGGTTGTACCACTGGCGGATCAAGTTGTAGAACTCCTCCATCGGGCACTTGCCGGCATCA
TGCAGTTCACCACAGGCACGGCACATGAAAAGGCAATGATCCGATGGATGACCCTTCCTGCCGCACTTCTCGCAAGTCAgtctcttccagcagttAAAGT
CGTCATGCTTCCTGGATCCGCAATGGGGACATTGCTTCGACTGGAAGTTTGGGTCCGATCGATCCTGCGATCCCACCGCGCCTTGGCGTGGCGGCTGCGA
GTTGCCTTGGTCCTAATGATCAGTCTACGCGGCGAGATAGATCGGGCGCAAATCGCTTTCCGGTTCCGATCCACTGCcgtccgactcggactcgcCAAAG
TCTTCCGTCGAGCGTATCGCTCGAACCGCACGAGCCGGTTTCGAGGGAGTCGGATGCGATGGCGGAGCAGCCTTCTGGCGGAACTTGCTCGATCCGACTG
CTGCCCTTCCTTGGCGGGTCTTGGCACGCTGGcgcgcacgcagcgcatTTTCGAGATGGCGCACCTCGGCCACCATCAGTAGCGCCAGCTGATCCACCAG
TTCACGGTCGTTCAATGTCTCAGTGAAGTGTTCGACGTGTTCTCGGCGAGCGTCCGGCGATCCATTCTTTATCGGCAGTTTCGCTCGCATTTCAGCAACG
TTCAGTCGGTGGAGATACTCGAGCGGTGATTCCTCGGATCGCTTCCTCGCGTGATAGTACTATCTCACAACAGACACTCCACGTCCGCAATACTGGATCA
GGAAATCCTCCAGCAGACTCTCCCAGCTGCTTCGAGTCGTCCTACGCAGCTGCCGGTACCAGTTGCGGGCTGGTCCCGTGAGCAGATCGCCGAAGACCAA
GCACTTCTTGCTGTCTGGAGACTGATCACGGATGAACGCCGACTTGACTTTGCCGAGCCAACTCCTGGCGCGatcttcgtcgttgtcctTCCCTAAGAAC
TCATTAAGTTCCGAGATCGCGGACACTCGGATTCGTGCGGCCGAAGTGGCGCCCCCAGTCGTTGCTTCAGCGGTCGCCACCACAGCACATCGGGACTTGC
CGATACTCAAGTCATCCGGATCGTATTCGTCCGCCGGAGGTGGATCCTGATCTGATCCGACCGACATCATCTCAACGTCCGGCTCGTCGATCTGCCTCGG
CTTCTCGGGCGAGTTTGGCATCTCACGCGGCGATGGCATCCGATCCTGCAGCtcacgtggtggtggcatcTCAGCCCCTTGCTGTTCCTTCAAGAATCGA
GACATCGCAGCGTTGAAGAACGACTGCATGCGATCTTGCGAGTCCTGGCCCGAGGTCGGCTTCGCCTCTTTCTTCCAAGCTTCCAGCATGGAGGTGCCCG
CCGGTCCCAGCGTCATCCGCTTCACCTCGATCAAACTgtctcctccagcatccgacgtggccgacgcgtACTGCGAGGATCCGCTGCGCGGTGCTAGCAA
CGTCGCAGCCGGCGTAACTCCTCCGACCAGAGCAGCTAGCTTCTCGAACAAAGCTAGCGTCGACTTCGCGATCGCGGCCAGTTCCAGATCGAACAACTCG
TTCGCGTCGACTGCTCCCGGCACGATTCCAGCTTCCTTCAGCATGCACATCAAGAGCttcaccgcgtccagcttgttgAGGACTTCCGTGGGCGCGGTTA
CGGGTCCTCGAAGATCACCGATAAGCTTCAGCCGCATGATCTTCAGAACTGGTTCCTCGACTAGCAGCGCATACAGTCCCTTTCGGTAGAAGACTGCTTC
AAGTTGATCGTCGGTCCAGTCCTCAAGCGCACTGCGATCTTCCGTGTCGGACTCCGGGGCCTTCAGTTTCATGCGCggggtcttcttcttcgagatCGCG
CGCGAGGCTGGATGAATGGTGGTAGATGAAGATCCCTCGGTTTTCACCAACGGATCTTCATCGTGCGGATCGCGACTGTGGTCACGACCCACGGGGGTCC
CCGGAGGGACCTGGGGAGGAAATGgaggcttctcctcgaggtCCATCGCTGGACCTTTCTCCTTTACGTCGTTGGAGCTCCTCCCAGGGCTCCGACGGCG
ATTCACCTTCTGTCGACGCACCAATCCCTGGCTCAACCTTGATCTTgacatcttcttcagcggaCTCGCGGTGAAATCCTGAGTCACCAGAAgatccggg
cacgcgcaccattgtggcggagcaggaatCGCGAAATTGCTAACGCGATCCAAGTTAGCCAACGGTTACCCAGACTACCAACTTACGGGGGAGGGGTACT
CCGTTCGTCCGTGGGGGCTGAAGtcttctcaccttgtgtacccgttggCTGGGCGGGTTACGCTCTTCCGGTaacggcgaagacgtctGTGCGATCTTGA
GTTGAGCTTGTGTGGACGGTACTTGGGGGATTGTTGGTGACAGccgcgtggaaatcttcactTGGCCGTCGAGTGGAGCCGATCAGGGTCTTGGATGTGC
CTTGATCAACTCGTGGGGGTGTCCTTGGGGGGTCCTTTCcgtgcttgccgcttcctgttGGCGGGATCTTTGAGTggagagaaggt