Description :
From Genome Similarity Track
Location :
Scaffold_8:24935- 29856
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_8-snap-gene-0.44Vacuolar protein sorting-associated protein

Sequence
4921 bases(100 bases per row)
TTTGGAGAAGTAAAATTGTGCGAACACACGTTGTGTACGAGCGCATTCGCTGGAGTGTGCACTTGGAACAAACCAAAGCGGCAGTACGTATTCAAGCGCG
TTGGAGGCGTCGACAGCAACAAGTGTTGCCGTCAGAGTCAAATTATGAACCAGAAATACAAGGGAATGCTACTGGTGCTGTATTTGCAGAAGAGTCTGAG
ATACCTGTGAATGGTGATGCATCAAGTGATCTTCTAGACGGACCGCTATCCAGTGGTGACAACAGATTGGAGGGTGCTGCGAACAACCAGGAATTTGGAG
ACGCATGCTTGCCACTCAGTACAGAAGAAACCCAGGATGGAAAGGAAAAACAAGTGAGCGACGACGCTGATGCTGTAGATGACGTTGGCAATGGAAAGAG
TGAGGGTGATGAAAATGAAGTTGTCGAAGAGGGAGAAGGAAACTCGTCTGATGTCCAGTGCGGAGCTGATGGAACTGCGACAATCGGTGAAGCAAATGCT
GAGTCTATGCACGAATGTGGTGCTCAAGCTGCCAAGAAATTACCGAAACCAGCCAACGATCTTCCTGAGAATTTCGAGCCCATGACGGGCAAAGATGGGA
ACGAACTCATGGCAGAACAACAGGTTGTAGCAGAGATCGAGGAAGTGGTTGGCAGTATGCTGGACACAATCTCTGTCATGGTTTCCACAAGTTTTCTCGA
AGTGGGTCAAATCCACACACCCGAGGGATCTGTGTTGGTCGAGACGAAAACGATGACCTCAAACGGTAGTGCCAGTGAAATGGGGAATAAAAATGTGATA
GGAGATGCAGTAATTGTCAATGATGGGGATGAAGTTTCCGATCTGCAGGACGAAAAGTGTCGACAAGGGAAACTGCAAGATGTGATCAGTTGCATCGATG
ACTTAGGACTTGACCTAGACAGAGCAGAAAATTTCGACCGTCGCGTCTCTGACTGTCCAGCAGAGCGCATTGATCATGAGTTGACAGCGCGATGCGAAAC
TTCAATGTCAGCCGATGTTACCAAATCTGAGGAGCTCCTTGTTCTGGTCGACACTTCTGTGAAGCAGACAATGGAAACGTTACTAGATGCACTGGAACGC
ACTCAAGCGCTAGAAGAAATTGCAACATGTGCAAGTCCAGAGACGGAAGAACTCCAGGAGATCGTCGAGGGCAAATACTGCGGATCTGATACTGTGGGTA
ATGTGAGAAGTGGAATCCCGCTGGACGTCGTAACGATGCTAGATTTTAGCCCCGGTGGCATCAATGGTGACTCGGCAATATCTGATGAAGACGAAGTGCG
GGATATATCTGAGTGTGCAGACGCTCCTGCAAACGGTTCTATTGAGTCGTTGAACACTACTGAGGAGCATACCAGACACAGTGAGTCGTCGACTGTAGCT
TGTCGAACCATCGACGAATTGGAGGGATCAACTGGAACTGAGGCGTTGGCGAGCGTGTCCGAAGCAGATCGTACCGATAAAGATCAAGCGCTGAATGTGG
TTTTAACAGATGAAAATGAAAATGAGCTCCAGGTCTCATCTGAGCATAACGTTGAGGTTGAATCGGAACAAGTGCTCGTCAATGATGCAGATCCAGTCAG
TGGAGACAGCCTGGTTGAAGCCCACGCAACCAAGCGTCGATCTCCGCGTGATCACTCAAATGCATCGGATGAACGTGAAGCAGATGATCCAGGAACGGAA
GACATGTTGGCGTTGGTGAACGATAATGACTCTCCAAGCCATGAGGTTGACCAGGTGCACTATCTCTCAAGCGATGCAAGTAGTTTACCAGTGTCGGCTT
CCAATCGCTTGTCAGCAACCTTAACCTCTGATATCTCCGCTTTGGAGGAAAGGACTACTTTAGAAGACGAAGATGGCGAAAGCGATGGCCAGCGCGAGTC
TAGTGTGGATTCGAACGACTTGATGTGGGAAGTCGACGAAATCGCATCATTCGGGACTGATGTGGCAGCAGTTTCTCAATCTAATTCTTCTGCAACGAGA
TCGCGCAGGTCATCAAACAACTCGCGGTGGTCTGGTCTGCGCATGGACAGTGAGCGGATACTCGCCGATTTGACCCAAATTGAAGGAGACAAGGTGTCAA
AAGCATCGTCTCATGCGAATCAGGAGACTTGCGAGGCGCTGATAGAACGAACTCCATCAGTTAATCCTTCTATTTCATGAAACTTGGAGAGCGAGGAATG
ATTGCATGAAGATGGAGCGAACCGATGACCAGACTCTGGCGTTACTAGTGATGGGCGTGAGGTGCAAGATGAGAGAAATTGTAGAATCAAGCGTTCATCA
ATTGGCTCGAAAGAGCCATTGATGGTGAACAGTGCTTATTTATGGTGAATGTGTCCGCATGTTAATTTTTTACGTAAAGTCCACAATAAACTTGTATTTT
ACTTGAAAGGTAAAAACCTACGAAACGGCATGCTAAGCTTATTGCTCACACAAAAACTGCACTACAAACAGATTTGGATTTGCAGGAGTGAAATGAGTAC
CTATCGACACATGTGCATTGTTTATTCTCAAAAAAGATGCAGCTAGCTTTTCCTTCACGCTGCTTTCATTCATACCTCTATCTGCTGTTGCCATTGCCCG
CTTTCTCATTTCCGTCGCCTACTGCTGCTGTTGAGGCTGGGGTTGGGACAATGAGCTGAAACTCCTCGTTGGGAGCAATGTCGGAATCCGAAACATCGGG
TACTCGAAAGCGCCGCGCTGCTGATGGTGCACTGGCCACGGCGACCGATCAATTGGCGAGGCGCCAAGGGCCCACTGCTCAGTCGCCATACTACCCGAAT
TCGTCTTCGTGATGAGCGACCTTTCCATTTGCTGCAGCATGGCACGAACGAAAAGCATCTTGCTATCCGGGAGCGCGACGATGTACTTGTTCAGCAGCAT
GCCATTCAGCACGACTGGTGCCCGCCGTCGTTGGTTGAACTCTTCTCGGATAAAGTAGATTGTCATCTCGTCGTGACCTTTGCTCTCTATCATGACGACT
TCATCGGCGAGAAGTTCCCATTCAACGTCGTACTTCTGAGACCCTCTTACATCGAGCAGGAGGATGCGCTTGCGTGTGACCAGGAAGCATTTCTGTTTCA
GGTCCACATGACCTAAATATCCATCGGCGCGGTATCGCCCGCCTCGCAGTTTGCTTACAATCTCTTCCCCGAGCGACTCGATGTACGAGTACACTTTCAG
TCTTCTCGTCCGGAAGTCGATAAAACGAGGTGGCCGCACACGTCTCAGAAGCGCTTTTGTGTTTGGATCGACAGCATCTCGTAGCGTCGCTGTAGTCGTC
GCGGCCGCGAGTGNNNNNNNNNNNNNNNNNNNNNNNAGAAGCGGCTTGAGAACCAGACCGAACACACCAGCAAAAATCCCCGGGACCACGCCTCGAATAC
CGTTTACCTCCACAGAGTGGATGGGTGACACGACAATACCAGAGATACCCTGTGCGAATCCCTGGTAGATGTTTCTTGTTGCTGGATAACCGGTGTAGTC
GTCAAGCTTCAGACACGCTTCGGAGAGTCCAAGTGAGCTTGCGGTCAGAATACGCGAGTTGAAATCCAAGAATGTGTACACTGAGGCTCGAACCAGTGAT
AAGGTTCCTCTCCCCATTCCAAATGCGAACTCTTGTGGACTCTACGGTTCATGCAAACAAAGAGAACAGCATACGTATCGAGTTAGTCATCTACAACACC
TAGTGCACAATTTGACTTGATCGTACCTTCGATATGCCGTAAGCTGGTTCGTAGATGAAGTCTTGGAAGCCTCCTTTCAGATTCTTCCACGCGATCATCG
GGTTGCCCAGTACGTCAACACTGCCTAAGATCACATACGCCTGACGGAGCGCTTCACTTTGATAGTGAGAAGTCAACCGAGTGACCAGCGCGTCAGGCTG
CATGAACGAGTGATTAATCTCAAGCGCCTTCAGCTTGAACGGTGCGTTGGCGATCTTGGTCAAACTCGTTCCAATTGCATTCAAGATCAGTCGGAGCGGG
CCAACCGTGATGACGGAAGAATTGCGTGATGAATCTGAGAAGGAATGCATACTGGAGCTGGAGGCAGAACCACCATACTGTCCATCAACGATAGCGCTTG
CACCACTCCCTAACGTGAAACTCACTGTCGCCTATTTACATGCATACAACACAAATTAGGGTTATTACTGCATAGGAAGGAATACAAGTAAACTAGATGA
TGAGCTGCACTTACTCGGATCGGGTCGATGTAGAATTCTTCAAAGTAGAGCTTCTTCTCCTCATCCTTGGTCATAAACTTACCTTGAATTGGGTAAACTG
GTATGGACGCCGAGTAATTCTGGCCGTTTGTGCTGACAAGATAGTTCTCGTGCATAGAGGAGCGGTTCGTGTGTAGTGACGCATTAGATGGGGCGGCTGA
TGTCGATTCTCCCTCTTCACGGATGGCGGCCAAAATCTTCACATTCACTTCGAGGCTCGCATTGAAATCTTCTAGTAGCAGGTTGTTACGCACTCCGCCA
GACGCAGCGCCACTCTTGGATTTCCCCATGTAATCTGTGCTTGCATTTGCATGGATCATGAGGGGAGCCAAGTGGGAAAGAAGAGATCCATCGACACGAA
TGTGGACAGGGAGTGCCGTGGCGCTGAAATGGCGAATGAAATTGATCCCTGCGTACTCGTCGTGTTTTACCAAGTAAATCTGCAAGGCTGGAACGTTCGT
AATCTCCCCATTCATATTTTGTGATCTTGAAGCTGAGTTGGAAAACCGCAACAGGACGGGGAATGGCGTCGTTTGCAGTTGATTGTCGATCTGTACGTCA
CTGATTTCGAAACGAGTTGCAATTATTCGAGCAGTTGTTTCGCGTTCCAATCGGGATATCGCTCCATCGCTTCCAGTGATGAATGCACTTGTTTTCTCAC
GATCTTCTTCACTCATGATTA