Description :
From Genome Similarity Track
Location :
Scaffold_43:249277- 257061
Transcript NameFunction/comments
Phyin_T30-4PITG_16173Putative uncharacterized protein

Sequence
7784 bases(100 bases per row)
TAAAAACATTTAATTTCGTACGAACAAGCTTGCGTCCTTTTATTGTGCAATACGCGCCCTAACCCACTCTTTGTTGGAATCAACGGAAAAATGCAACGTT
GTAAAATCATCACCCCAAGCAAAATTGAAGGACAAAATTAAAAGGCGTAAATATTTTAACATTGCGCTAAGAGCTAATAATTTTATAACGCCATCCAATT
TGGCTTTCCCGACCATTTCCATTTCAATCACCACTTCTTAGCGTTCTTCGATACGGCGCAAGCCGCAGTGCACTAACGAGTAGCGCCGACAGGTACAGAA
GCCTTAAATCCCTACCGTTCTCCTATTACATACTAATATGTTATATATATAGGCTCTACTCGATGTTACTGCTGCAGGAAAAGTAACCGAGGAGCTGGCC
GCCAAGTACAGAGTCCACCGCACAACGCTGTGGTGCTGGGCTAAGGCAGAGGGCAACATCATCAAGGCTCAAGTAGCAAAGCCGAAAAAGAAGGTGATAA
ACACGGTCAAGAGAGGCGTAAAACAGCGCTTTCCTCTGTTAGAATCACGGTATGGGTTTGAGATGACCACTTTGCTTGATGAAGAATTGTTTACTAATTG
TGTATCTTTCCAGTCTTTTAGAATGGTTTACGGGTATGAGAATGAAGAACTTAATATGTACTGTACGTCCAATGACAAAAATGCTATAGAATTCTTCTAA
TTCTATGATTGAGTATGAAGTAGGTGTAACTAGTCAGTGTTGGCTGCTAGTGGCTGTCCGCTTCAAGCTGGAGTACCTTAGTGGAAGGCCTTTGGATGCC
GCCGTGGCGAGCATCAGGAGCCTTCGGCTTCGCAGCCGCCTATCAGTGTGTGTTATCACCCACCGAGGCACAAAAAAACGTTCGGGGCTGTAGGTAAGCG
GTCTCGAAACGCTTTTATCGTACATTTTCTGAATGTTTAATTGTTAAAGGAGGCTGCGGACAAATTTTCAAGAACTGTCATCTACAGCCTAGAAATGGAT
GGTCTGCTTGCTGATATCCAGGGACCTAAAGGGTGATGTGGATCTTGCCACCATATTTAATTCTCCACGTGCTCTAGTAGCCCCTGTTGATACGGATTCT
CAATAGGCTATAATTGGTCTCTCATTTTCTGATTTGTTAAATTATCTGACTAGATTGCCAATCCGTGCAAATACGGCCAACGTTCATCATCAGCCTCCGT
TCGATCCGCAACCCCCACCGAGCACAAGCCATGTACTAAGGGGTCGGGCTGTATGGCAACAGCAAGCCTGAGGCCATAGCGGCCGGCAGCGCCACGTTGT
GATCTGACCAGCGCCTATAACGGTATGCTACGTGACGAAACATGTGCCGAGGCCACTCTCGTTGAGTTTCACATCTTGAGTCGACACGCCCCAGCGTCAC
CCCGCCCGTTAACGCATTTTATCGTATAACGAGGCCTGTGAGGAGATCACAGACAAGACCTGTTGCAATATGGTCATGAACATCGCACCCGACATAAGTT
CGACCAAGTCCCCCTCCAGCTCCTGCGCCACCCTCCTCTGCGAGAGTGAACTGCCGACGCTCACCTGCACCCGCCGGACGATACCAAGACGCACCGCTGT
CCCAGCTGACCTTCTTCTTCTGTCCCATCGAATCCAGCTCCAGCTCAACCACTACATCTTTTACTGCACAGCTGGCATCGACTGAATACCCTGCCAACAT
AGCTCAGACCACAACCACCGCGACCCCGGAAGACCGTGGTGACCACAAGTCCAGAGCAGTGACTGCATTGTCCAATAGCACCAACAAGGCCCCATTAACC
AGCAGCACGTAAACAGCTACTCAGACTTCGACTTCGACTTCAAGCACCTCCAAGTCAGCGACGTCGAATGGCAGCACGGCATCGTTTTCGAGCGTCACCG
TAAGATCTAATTTCGTATACAGCGGAACGAATACCAGATCCGCTACTGGCACGTACGCAAGGTGACGGAGATGTCTTTTTGGCACTACGAAAACCGTATC
GGTTAGTGACCACGTCGCCTCGTTGACTAAGAAGGCTTTCCTGGTTTTTGTGTTCCTATGAACATCTACAGCATCGCCATCTTCAAAGCCATCTCCGGCA
GCGACCGTGCCGTCGTAAAGCCCAACCGGAACCCAGGACAACATGCGCGTTACGAACAACCCTGAGCAGTACACCTCACAATCCTATCCAAATGACTAAC
CGTAAGCTGAATAACCCCGGAGCTGATTCGAGCGCACTTGCTTCGGCTAGCTACGCGCCGCGAGCGTCGCGAACAATGGACTTCGGGACCGTCTCCGACT
TCGTTCTACAACGCCAAGCGGACACCTACTGCGTTCAAGACGCACTGCGGGACGCTGTGGGTAAGCAGAAGAAGAACGCGGACAAGCCTGGCCCTCCTAA
CGTGACTCCATATTTACGGCGTTATTTACTTGCTGTTCACGGTTATGAAGGCACAAAAAATAGAATAGCACACTCACCAAGCTTTCGAATAAGGGTACTT
AGACTTTTATCAAGCTCATATTGTTATTCCATATACGTTGGTGGGACAGAGAAGTAAATAATATCACTGCATAATGGCAGCAGCAGCTTACAGTATCGAG
CGCGTGTCCAAGCAGCTCGTAATCACAACGCGTTGAAATTTGACGTCGAGAAGCCAGTGACGTCCCCACCTGTAAACGCAGTCTGGCTAAGCGGCAGCGT
GCCTTCCGATGTCGTCAGTGCGTATATCGTTGGACACATAACTCTAAAGCAGTTAAAAGAAGCTCCCTAGCATTCAACGCTGGTGCCGCCGCCGGATAAG
TGATCTTATCTCGATGGAAAATAGTTAAAAAAAAGTGTCAGTTGCTGATCGGATATAGTAGACAGGCCTCTCGAGAATCAAATTGTTGCGTCGAATTCTG
TGCCAGCTCAATTGCATCCAAAGCCTGAATCGTGGCCAAAGGTATGGATCCCAAAATATCTGTCATTTCGCTACGCTCATTTTCTTCTATCGCCACCGCC
CCCTTCACTTCACTATGATGGACCTCATTTTGCTGATTTGGTGTCACTTTCTCCGATTCCAACGCGTTTCGTGTAACTACCGGTGACAGTATTTTTAGCT
GTATATTCGTACTAGCTGATCTTGCTGCTTTACTCAATGCATTCTCTGAAGATTTGGATGCTGGAGCGGCTGCCAAATCGGTAACACCAGCGAGCTACGA
CGACCACGACGACCTCAACCGCAGTAAGAAAGATGAGTGTGGAATTGTTGTCAGATTCCTGTCAAATGCTCCCTTTAGAACATTCAATTCGCTGAGCGAG
TTGCACGGGACTTCGTTTCCAGCGTCGCATCTTCTTGACCTTTACTTCAAACTACTTTGCTACCGTGCTCTGTGTAGGTGCGAGCGAGCTGCACTAACAC
CTTATCTTCTTCCTTCAAGAACGCGGTTCTAGGCATGGCGACGTTTCGGAAATCTGCACGACAGCTCCAGCTTGCGTTAACGGTCGAATATGCAGTCATA
TTGATGAGTCTTTTGAAAAGTTGTCACTGACAGGGGAAATTGATATTGCTTTTATTAATAGTATATACAGTAATCTTAGAATTCATGAATGAAAGTACCG
CTGTCCACCTCCCCTCTGCCGATACAAATGCTCTTGTTACAAATCGCGGTGTGAGGAAGCATGGATACACAGCAAAACGTGCCAATTAAGCCCCTTGTGA
AGCGTTTTTTAGCGGATCTTGAAAGACCGACAAAAGGTGCTATTGTGGCATTTTGTTTCACCCTTTTGCGGCGAAATATTACAACTTCTTTTACCTCATG
CAAAAATATTTTAGCCAACCAAAATCAAATATCTAATGAACATAAGCTTAGCCACTCAAGGCTTAAATTACAATTACAATTCCAAACATATCGAAGGCGT
GTTACGGCCTCGCGACCAAGCAGTGCGAGCGGCGCGAGAAGGCAATATCTCGCACGAGCTTCTTCAAGCACAAGAAGAGCTGCAAGGGCATTAAAGTGCA
CGGCTCTTGGGAGTGATATCCGGACGAGGTCGTGGAATAAGCACCGCGACAAGCGTGTCGGAGAGCAGCGCAGCCGCCGCGCTAGCTATTTGTTCAAGAT
ACTTGAAGGTACCATATATTAACGATGTGTGAATGTTGGTTATTTTATTATAATTTAAAAATGTATTAATCGAAGCCAGGGCTCCGACAGAAGCTATGTG
AGCTGAAGGAAGAACCTCTTCCCTTAAAACCCGAGCCAAAAGAACTATGGAAGCACCCACTGGAGGTGCTAAGTCGTAACACGGTCTTATTCGACTTCAT
TTCTTCGAAGGTATGTGTATTGAGCAGCAGTTATTATACTCTATATTGACGGACGTACCGTGCAATAAAAAGAGAACGTAGACTTATTGTCAAAGCTGTG
GTTCGATACCGCCTATCTGATATTGTACCCTGACAAGCGCCATTTGGTACCGTTAGAGCTGCGTGCAGGGTCGGCGCGGCACATATCCAGGAGACATGCA
AGGCAATGAGTGCATACAAGGAGGAAATGATTACGGCAGATGAGAACACGATTTTTGGAGAGCGGATATGTCTTCAAATATTGGGACTACCACACGGCAA
GATATCGTGCAAAGGTAAGCACATGGAAGGAGGTGTGCCATAAGGTACGCGACCAGAATACCGTGCTACAAGAACCGATCCGAGCGCAAATAAATAGCTT
TGGTGAAGCAAACGACTGCTCAACACTGGTGGAGCTCAAGGCAGTTTACAAGGCTGGATTTATTGAGAAGAGCTAAGCTTACGAGGCCAAGTTGAAAGCG
CAGGAAGAGCAGATGACAAGCGAGCGCCTCTTTAGGGATACGTTTGGTCTAGATTTTGATAGTAAGAATGAGTAAAAAAACCAGTCAGGCTTGACCGACC
CAGTTTAGGTTGACTTCAACTCTAGACTGAAAGACATTTAGTTTACTATGGTAGGACTGTAAGTAATATGACAAGACTAAACACACTTCAACAAGACTGT
AAGTACAATGACAAGACTTAACGTACTTCGACAAGACTAAACGTACTTTGACGAGGCTAAACGTACTTAATTAACCCCTTGAGCTCGAAGCATTCTCCGC
GCCCCCATCCGACTAAAAAACTTGTATCTCCGGGTAAGGGTTAACATATTAAAATTAAGCTTTTTTGATATCGTGTATGTTGGATAGGCGTGCACTTAAC
CTAGTCTCAGAAATCACATCATCCTGCAATCGTGTATCTCCAAGCTATTAACAGCAAGTAAGGCGGTGTTATCGTGGAACCTGTATACACCTTGATAAAA
CAGGTGCATTCCCGTGTTAAAAGAAGGCGTTCATAGAACAAAGTCGTGCTACTCAAATACAGATGCTGATCAGTCTTGTGATTGCTGAAACTGAGTATAC
TGAAATCAAAACAATTACGGACACAACAATCGATTACTCCTCCGCCTCGACCGTACGCGCTCGCTTTGGCGAGGTCTGTCCTGCACCCGCCGACTCGTCA
TCCGATGAAACACAACCTTCCTCGTCACTTGCAGCCAATGATACTTGAGCTGGGGTTCGCGCGCGAATGTTCCGCTTTCTCGCAGTTTTGGGGAGGAGCG
TACCATTTCGCCACACTCTGTGCCATATATCAAAGCACGTCATGAGGGCGCCGTTGTGCCTGTGTCGAGCCTTGTCGCACAAGAACACACGCCATGCCTT
CGACTTCTTCGACGGCGTCGCCAGCTTGCAGTCACTGCAGTACATTGAGGAGTCCCCGCCACGCGCCCCATCTGTTCCCTTTAGCAATGAGCACACCTTG
CATACCCGGGTCCGACGCTTCCTCCCAGCTTGGTTGTTACCGGGGCGCCACTCGTCGTTCTGGACAGGAATGTGTCCAGGCTGTTGCGTTCTCGACCGAG
ATCTTGACGGTGTTGCTGCCGCATCTTCGTCGTAAAGCAGTCCTTCCCAATCGTCGGGCCGCAACTGGCATAACTCCAAGTGCATCTGCTTGATAAACTT
CACTTGACTAAGCTTGCGCTGTCCATCTGCAACGCGACGAGCATTGTAGATGATATAGGCATTGATGATGGCGAGATCGACAAGCCCTAGGAATAGGGAT
TTGTAGTACTTCTTGTACTTGATAATAAGTTGCAGCGAGTACCTATGAAGCATGTGCATACACGTTTAGAACTCGAAGTAAGATGTATATACACTGTACG
CACACTTACCTTTGTAAACGAAGCTGGTCGTGAACGTCCACTCCGCCCATGAGCGTCTGATAATCTTTCAGCACTCGTGGGCAGGCAACTTCACCCTGCT
CGCCGGTCTGCTTGTCTCGCCGCACTACGCGATCCATTTCAACGCTTCCCCCGGATGCAAGCATATACACCGCTTTGTTATCCCACCAGCGCAGCGCCCG
AAATCCAGGGATCTGCCGGTGCTCAGTTACATCAAACGTACCACGTTCGATCCGTGCTGGGCGATTTTTTATAGGCTTTTTCTTCTTCTCACCTTTCTTC
TTTTCGCCAACAAGAGACGCTGGCAGCCCAAGACGATCCGTCTGCACTGTACCCACACTGTAGAAACCCATGGTTAGCATCTGCACTGCCAGCGAAACCG
ATGTGTAAAAGCGGTCAGTGACGATCAGCCTCATGGCACCTGTGCCGGGTCCTGTAGGCCCAAACACCTCCGTGAGATTGCGAATAACTGCTGCTGGCCC
AGACATATAGTCTGTCAACGCGCCACTGACACCCGCATGTTCTTGTTTTCCACAGTAGACCTCAAAACTGTCCATACATGTTTACAAATGGGTTAGTATG
TCAGGTACATGTTAAGCATACTTAGGAGCCAAAAAAAAAAAGAGTGCTCCTGTTGGAACACTCGTAACTCACCGGATGCAATACGCCGTCGTTGAACAAC
ACAGCATGAATAGCTTGGTTCCCCACTTATGAGGTTTATCTTTCATGAAGACTCGCATCCGATTGAATCTGGACCGTGATGGCAGCATGGCTTCGTCAAA
AGCCATTGCAGGAGGTGGAATGTATCCCCGCTGAAATCGCTGCGTCAAGGCGTCAATCACAGGTCGAAGTTTCCAAGCCTTGTCCAGCTGTGCACGTGCG
TCGCTGTTGGAGCTGAAATGTAGGTTGCGTGATATGTGCATGAACCTATCACGAACCATGAACTGTCCGAAGCAACCTCGCGGGATTGCGCCTTCATCGG
TCGTTTTCCAATGATGTTCAAGCTTTTCCTTGTTTGGAGAAATAGTTCGTGCTGCCAGTAGCCCTATAAATACGCACAACTCTCGGCCCGTGATGTCCTC
CATCTTCTGCAACTCCAGTTTTATCTGTTCACGTTCTTTGGCCTTGAACTTCGGATGTTTGAGCGAGCGAACCACTTGTTTCTTGAGCTGACCTTCTACT
CTCTCGTCAATGTTCTCAGCGAAGTAAGCATTGCTTGTATCTGCAATGGCCTCCCAAAGGGTTGGCTGGGCAAAATATAAGAAAGCTCCCAACGGCGTGC
CCGCAGCGCGCAAGGCCTCTTCCGTAGGCCCGTGAACACCATCATACAATCGAGGGTAATCGGTTTGCATTGATGTAGGAGACCGCTGCTCATACGGCTC
CATCATATAATCGTGCGGCGTCTTTTGCACCAATGGTGTCCATCCCGTGTTAGCCATATCTCTGAGCAGGGCGCTCGAGATATTGCCCGATGCAAGTTGG
TCAACACCCCCAACAGATTCCAGCAGCGCGTCATCGAACAGCAGATCAGGCTGTAGGCGCTCCTCATCCGGGTCCAGCTCAGAT