Description :
From Genome Similarity Track
Location :
Scaffold_1354:2492- 4122
Transcript NameFunction/comments
Phymu_g13156folate-Biopterin Transporter (FBT) family

Sequence
1630 bases(100 bases per row)
TGCTTCAACACCAGCCGTTGGATGTCATTGTTGATAGTGGCAGAAAACATGAAGTTGTCAACTTAACCCAACATTGAGGAGACTTATCACACTCGCGATC
GCAAGTCTTCCCGCAGGCTTTAATACGGAATTGGCAGCTTAACGCACTGCTCCACGCCAGGGTAATCGGGCAGCTCCAGGCTGAACTCTTGCGCCAGTAA
CCTAAAGCGATCATCAAGTGCAAATGCACACCATGTCAGACACAAACGACCCTATCCGATGGGAGCAAACGCGCGCATACTTTGGCACGAAGCGTCCACC
GACGTAATGAACTTTGTCGGGGCCTGTAAAGAACTTTGCGCAGAGCTTTGGAGCCGTCAACGAGATTAACATTTTCGGCTCCAAGCCAACTCCATCTTCG
TTTCCTTTTCGTACAAAATCATTCAAACACAATTCATCGGTAAGCATCCTCGACTTCCACGAGTCGTAGCACAAACGCGCACCTTTCTCAACGTGCCATC
CCGACGGAATATCGATAGAGACGATCGGCGTCTGGCACCGTTGAAGCGTTCCGACGACGTGATCAAACGGTGGGCGGATGCTTCCGGAGAAGCTGAACCC
GAAAATACCATCCAGGATCAAGTCGTACGCAGCGTCCACAGCCGAACTgccgcagcaacagcataCACGTCAGCACGCTTTACCTTTTCAACCGACATCC
CCCCCTTCCCCAATTTCTTACGCGTTTTGAACCTGCTCGATGAATGGAATCTCAAGTTGTTCGCACTGCGTAACCAGTCCCTAGTAACCGAAAGATCAAC
AACACTATCAATGGCCCCGTCCCCATTTTTCATTCCAACCGGAGTCTAAAACCTGGAATAGAGGCTTCGCGCTGCGCTTCGGGTATAAAATGCTGGGCGA
ATATCCAAAATGCTGCAAACAAAAAACACTAAATTATCAACACCTCGGCCATCGTAGAGCCCACATTTATGCGGCATTACCACCAAATGCCGAGCAGCTA
CCAACGCGTCACCGCTATCCACACCAAAATCAAACGAAAAATCTCTCAGTCCGTGGAATCCACGGAAATATCGACGTTTCCACTGACCCGTTGTTACCAG
GACCCGCGACTACCAGCACCCGCTTGAAGCAcccactagcagcagcagattctgcagTCTTTGCACTGCTTGGGAACTGCTTCCCGATCGCCGCAGCCAC
ACTGAGACCTGCCAATTCCATCAACTGGTCGATACTGAATCCGTGCGCGCTActcatgagctgctggtcgaaaCGTTGCGCCTCACGCTGTCCTAGGTAC
TAATAGAACACCCACACGGCATAAGTCCGTCATACCAGCAGAGACAACACACACACAGCTCTTCCTTCATACGCGCGTCATCTTTGTCAGGCCCTCCGAA
TAAACGATTGTACTGTAAATATAAGTTCGGAATAATTTAATTTTTGCTGAGTCAGAAAAGTATAATAACTTACGATTGACTTTTTACAAATGTGTTTTTA
CACCGAAAAGTGCTTTTATACCCGTAAAAAGTGCTTTTAATACCCACGAAAAAGCTCAATGTTGGTACCGGCATTCTCCTCTTATAGTGGACAGGTCATG
TACCGGCACACTGTACCACCTGACAAAAGT