Description :
From Genome Similarity Track
Location :
Scaffold_6:249175- 251094
Transcript NameFunction/comments
Hyaar_Emoy2801271hypothetical protein
Hyaar_Emoy2801272hypothetical protein
Hyaar_Emoy2801273hypothetical protein

Sequence
1919 bases(100 bases per row)
TGCGTGGTGCAGGGGTGGCATAGGGTGACAGTACGGCCGACATCCGCTAAGACGGCGACACTTCAACTCAGGTTCGACGATACATATTCGTATAAACACA
ACTATCGTGTCAATATTAATCAGATCATTAAGTTCTTAATCGCAATGTGAAATTAATAACGACTATCTCACGTATGTTGTCGAGTGGTTTCTTGTCAGCA
ACGATACGGTAACAAGTTGTGATTCGACACTACCCAACAATCTCAACATCTCGAAGCACCCTCTGTATTAATCAACAAACTAATGAACATACTGTAGCAG
CATGCCAACATTCTAAGCTACGTCAACATGATGCGTATACTGACACTTTACCCCCGGATGCACATTACGTGCCAACAAAATGATCGTATTCGTCTGACGT
ATCTAATGGCCAGTAAGCATTTGCTCCCGCAATTCTACCAAAACTTCGACCAGAGTCTGACGTTCAGGTTTGACGACACCGTCATACACCTCAGCCCACT
CACCTCTAGTCAGCCTCGTACCTTTAGTCTACCTCGTCTTATCTGTAGTCAACCTCTTACCTATCGGTCAACGCCTGCAAGCGCTCGAGTAGTATTTTAT
GCTTTTCCGGGGCGATCCAAGCGTTTTTGGCTTGCACCGTCTTCAAAAACGCGCCCAGTGAAATTAGCTCTTCAATGCTGAACCGTGTTTCGTCAACTAG
CTCCGCAACGAGCTTCAAGATATTGCCTGGTTGGGGACCCAAGTAACGAGGCGCCAAGGTTGTCGAGAGATCGCGAAGAATCGCTTTAACATTGCCCACG
ATTGTGTCATCATACTGATTGAGGTAGGCTAAGTAAGCGCGGTACTTGACAGGGTTGTGCATACGCATCTGGATCGCCTTAAAACCACCTTCTCCAATCT
GTCTCGAATACTAAAAGACGGTTTGATGTTCGAAGCAATCAATTCATTGAAACGGATTTCTTGCATCGATTCCGCAAGCTCTTCAGGTCCGGATAAGGCA
TCAACTCTTGAAAGTAGAATCCATACTCTAGCCCTTGTCGTCCGGATAAGTCTTGCGCAGTTGTCTCAAAATATTCACAGCAGGTTCAGCACCCACTTTC
TCCCAGTACAGCTTGGCGAATCGAGCCACATAATTCTTTCGCCACTCGAAGAGCCAACGATCTCCAGCACGTCTTCGGGCACCATTCCCGCTCGCAACCA
CGCTTGTATGAACGCCCCTTTCTTCTTTGCACTGGGCCTTCTCGAAAAGCCTTCGTTGCCACAGGATAGCGACATCTTTCTTCCTGGTGTGTTGAACATG
ACTGAAGAATCCTACTGTGTTCTCTATCGTTTCCGCTTTCTTCAATTTCTTTAACATCTTGTTTACACCCTGCTTGTATAGTCCGCGTTTTAAGGGATGT
TCATAGTCATCATGATACTTCCGGGATAAAGGCTATCTACTCCATACTTCGTCACCCAGTCCTCGAACACTGGAGACGCCGCATTCGTCTCCGCAGTGGG
TAGTCGCTCGTACCCAGAGAATCGTTTTGCTAGCCGCGAAGTCAATTCTGCAAATCGTTCCAGCATTTGCACCCATCCAACTCTCTCCTCACCACTCTGT
TTGTCACTCTTGGTCTGGCTCACAGCTGATTCGTGCGGTCGGTGTCTGCACCATACGCACTCGTGTTCAAACGCGAGACGTTTCCCAGATCCAGCGCATC
GCCATCGATCTGGATGATGTTCGCAGCGAGAAACACCGTGGTTACGAGGTCGTGGATATGCATGTCGTGTTTGTTGTTCGCTAGAAGATTGCGCAATGGG
GAAGACACTTGTGATGCCTCCCATCAATTTGCGTCCACGAATCCCACTGTCATTCTAAGGGTACGACATTGGAGTTAAGGATGGTACAGTACAGTCCTCC
CTCTGCACACCTTTAGTAT