Description :
From Genome Similarity Track
Location :
Scaffold_8:249171- 255777
Transcript NameFunction/comments
Physo_288695Hypothetical protein
Physo_260737Appr-1-p processing domain protein
Physo_522056PREDICTED: putative ATP-dependent RNA helicase DHX33-like
Physo_356907TonB-dependent receptor, partial

Sequence
6606 bases(100 bases per row)
CCGCACAACATATCGCTGGTGTCGGGGGGGCATCCTGAGTGGCAAATCACGCTGACGCCAAAATAGACAAATAGAGGTTTGTTAGGGGATTAATGCGAGC
TGCCATTGGTCAAAACAAACATGCGTTGTGGTTGGTTGTGGTACATGTCCGGAGGGACCTCTACTGCCGAGCTCGTAGCTAAAGGGTTAAGTAGTACAAA
GCAAGACCAAATATCCACGATACCTCGTGTGTAGTGCCCCCCTTGAAGCTCGAAGTATCGCTCCAGCCGAATGAGGCATCGAGGAGGGATACGTGAACGG
TCGTGGTAGAAGATCGAGACCTATTTTAATATTAAAATATAGCAGTGTTAAAACTCAATAGATGAGCTGACCCACATCGAAAGCAAGACAAACAGTGAAT
AACGAATATTTCGAGAAGCTCTGTTATTCGCTCGAACAAAAAATCACATGTTGCTTGTTCAGGACTCCGAATAAGATACAAATGCACTGTACGGCAGTCC
CGAGTTTGCCTCAGCCAATGTTCCTTAGTTATCCCAGCCTACTCAAAGCTCTCGTGGACCGCAAATCAAAACCGAGTATCATTTCTAATCCATGCACCCA
GGTCGTAATTCACAGGTAGCCATAATTACAACCGAGTTTTAGCTGGACAGACGAGTCGTAATTAAGACTTAACTGCCCAGTATAACAGAGAATTAATAGG
CTGGTTTGCAGAAATATCTGCAAAGCACAATAGTTCTATATAATGACAAAACAAATAATTATGAGTACATTTTTGTTTTGAATGTGTATCCATAATTATT
TTGTTTGGCAATTATTGCTCATTTAGGACGTCGGTCCATTATTAGCCAATACGAAGCGAGCCAGTTTACGTTTCCCCAGTACTTCCTCCCTGGCTTCTGT
CCAAGGCAGGCAGGCCCCCCAATCAAGGCAGCGGCGCCTCAATGGTGGAGGCTGCGGGGCTCGCAGACCCTCGACTCGTCGTCCAGCAGCTGGAGGCAGA
GCACGGTATCACGACAGCCGCCGAGTTAGTTGAGGTTCTGGAAGACCCGGAGGTGTCGAAAAGTATCAAGTCCCTCTGGCGCTTGCGTCTGAGCAAGTGC
ACGACCCCCGCCACAGCCACAAGAAATGGCGGTGCGAGTCCCGCTTCGCCTACTTTTGGGGATGTGGGAGGGCGGATTATCTCCCGATGGAAGCCGAGCG
GAGACGAAGGCCCCGAGATCGTCGTCACGCAAGGTGATCTCACCGAGTGCAAAGTGGATGCCATAGTCAACGCAGCCAATAGCGACCTCCTGCATGGCGG
TGGGGTGGCTGGAGCGATCTCTCGAAAGGGCGGGCGTGTAGTCCAAGACGAGAGCTCTGCGTGGGTAAACGCCAACGGAAGACTACCAGTCGGTTCCGCC
ATGGTCACGAGCGCAGGAAGACTCCCCGCCCGATACGTTGTCCACACGGTGGGTCCGAATCTGGGGCGTTTATCAGAACCTTCGCCAACTCAGACGGAAC
AGCTTCGAAGCGCTGTAAAGTCGGCTCTGGTTGTTGGTGGCCGATTGGGCATCTCGTCTATCGCTCTCCCAGGCATGTCGACTGGAATCTTCGGGTATCC
ACTTGACCAAGGAGCCCGCGAAATCCTTCGAGAGTGTGCGAAGTTTTGTCGCGAACAAACCACGTCAACGATTCGATATATTGTGCTCATGGACATTGAC
GACAAGATCGTGGACAGCTTCAAGAGGGCGCTTGAAAATGCAGCGCGGAGTGATAGGGTGTCTGCTCGCCGTCCCAACGAACCGGCTTGGCAAAGTTACA
GTGATTCAAGTGCTGGTGCTCAGTCTGAAGCGAATGACGACGACCCAACTACCCACAAGGCGGCGGGGGTGTTGCCAATTCGAGTGTCGTCGTCGGGCTT
TGACGTTCTGCTGGGTGTTGAACCGCCCGTTCGACAACCCTCCTGGGCAGTTTGTAAACCTCTTGGGAGGTAAGCGTGATCGTGACGAGACACCAATAGC
TACTGCTGGACGAGAATTCTCCGAGGAAGTCGGAGGAATAATTCAGAAGAAGGACACCCACCAGCTCTTACGGAAAGATCGCAGCCGCGAAATATGGATC
CCTTTCGCCAAGTACATGCTGTGCATGGTTTATTCGGACAAGCGCCGTGTACATTCGCTGCCTGAAGAGTATGCGAAGCGCAAGATAATTGGGTCGCTGA
GTGGTGATGCCGAGCACGAGTATCTTCTCTGGGTTCCTTGGCTTACGCTGGTATTTGCAGTCCAAAACACGCCCAGTAGCCCGGTTATCCAGACTCCGCG
TGGTGTAGTTTCGCTCTCTTCGATGCTAACGCGATTTGTCAAGGAATTTGGGGATGCCACGGGGCAGCACATGGAAGAGTTGGGCACAGGCACCGTGGTT
CGGGAAGAAGGAGCCCGGATTAAGCGATTGAAGTCGATGAGTGACGAAGAGTTGATTTCGAGTATGACGCAGCAGGACTGGAAGTTGCGATTGACAAGTC
CACCGATCCCGCCTCCCCCTCCGATTGAACTGTTGAAGTCGCACGATGCTGACTACAAGTCTACCGTTAGCGGTTTACCTACTGAACTGTCTGCCAACGT
TGTCAGTGTTCGTCGAGTACAGGCTTCCGCACGCATTGGGGACTACAAGAGTCACATTCAACGCTTGCAAGCTCTGAATGCATCCGTCAACGAAGAAGAG
CCCTTGTATCACGGCACCCCGGAGCCTTGGCGTGCTACTGCCATCGCATTAAATGGATTTGATCTCAGCATCCAACTTTCTGGACGATCTCATGGCGATG
GGGTTTACACTTCAGCGGATGTCAACTTTGTCCGCAGTTACTCGGGGAATGCTGGTTCTATCCTGTGTCTGCGTGGAGCTGTCGCCAGCAACTGTCAAAA
TCCGGGGGAGAATACGATTTTGCCTGGTGATCCCGTTCGTGTATTTCCAAATCCAAAGTGTGTGTTGCCACGATTCATTATTGACTTGGTAGACGCTGAT
GATCGGGACACCCTGGAGATGCAGCGCCAAAGTGCAAACGATGAGCACCGGTTGGCCATTGAGAAGCGCAAAGCCATGGAAGCCTCGATCAAGGCCCAAG
AAGCTGAGTTCTCGCGGATTATGGCGAAACGTCTGCGCACTGCGCTCACGATCTACACCCGAAGTTTCGAGCAATTCAAAAAGTGTTTCGTGCAAAAGCA
AAGCTCACAACTCGAAGCTTCTGCTCACAATTTGTTCATGGAGAGGCAGCAGTTTGGAATGTGTTCGCCCATGTACGAAGTCAAGCCGAAGGTTGTTGAG
GCTCTCAAGCGCAACCAAGTGGTTATCATGACGGCAGATACAGGGTCCGGCAAGAGTACACAATTACCGCAGATTATATTGGACAATGTTCTACCCCCTG
GTGAAACCCGCCGAATCGCAGTCCTCGAGCCACGACGGCTGAATGCCATATCGCTGTCACGTCGCGTCGCGGAAGAGCGTGGCCTTCCACCAGGACATGA
AGTTGGCTACACGATTGGCCGAGGTGAGAGCAATGTCACGAGTACGACAAGAATCGAGTTCATGACGCATGGGCTCTTCGTACAAATTGCACGAAACTGC
GACCAGCTGCTCTCCAAATACTGCGCGGCGGTAGTTGACGAGGCCCATGAACGCTCCGTTGACGTGGATTTATCCCTTGCGCTTCTCAAGCGCGCGCTGA
ATCAAGTACGAACAAAATCCGATGAACCTTTTTTCAAAGTAATTGTGACAAGCGCGACGATCGCAAGCGAGGCGCAGCATTTCCGTGCGTACCTTGACCC
GTCGAAGAAGAAGTCTTCAGTGTTTCAAGTCCGAGGGCGCGTCTTTCCAGTTCATATTGACCACCGCCCTGTGGTTGAGTTGGACCCCCAAGAGGTCGGC
ACTGCTGGCGTGAATAAAGTACTCACGTCTGCTGCAATCCAAACGGCCATGGACATTCTCCGGACTACGGAAACGGGCAACATTCTCATTTTCTTGGCGA
GTGAGATAGCATTAACGACGCGTTGGAAGTCGCTCGACAGGACCTCTTGGTCTCGTCAGGCGTTGAAGAGACTACGGATTCCGTTTTCGTTTCGCATGGT
GGTTGGCCACCAGGGAATCGTACTTTACGACGGCGCGCCGACCAGCTTGCGGAGCCCCATTCTGAGCGCCGTCAAGTCGGCGAGGTGGTCGGTCGGCCAT
CGTGGATACTGAGACCAAGTCAACGTCTCAAGTAACTTCGCAGTAAATTCTTGCGAGATGAATTTACACATTCCGTCATACTGCACTCCGCAAAGCTTAC
TTTGCGGGCCTCGAGCGTCGAGTGCAGTGGAACGCTTCTGTCGACGTCAACGAAATGATCACCCAGCCCATTACAATGTCTTCCATGAAGCAGCGAGCAG
GACGAGCGGGACGGACGGCCTCCGGAATTTGCATTCGGCTCTTCTCAGACCCGGAAGAGGTCGGTGAAGAGGAGAACGACAGTGACAAAAGGCGTCCTGG
GAGTCGAGAGTTGGAGCCAGGGGTGCAGAACGCCATGATCTACAAGGTCGTCCTTTTGGCTAAGCACATGAAGCAGAATATGAACGAGGAACTCGTGCTA
CTGGACCCAATGGACCCAAGCATGCTTGTACGCGCAGAGGAGAGGCTGCATGAATTGGGCGCGCTCGATGGAGAAGGCAAGCTGACCCCCCCCAAGGCGA
CGCGCTTCTCTCGCTGGGCATCGACTTACGCCTCGGTCGCTTTTTAATTGCCTGCAGCCACTTTGGTTGTCTCGTCACGGGCACAAAACCCGTCTCTCTT
CTAATGGCTTCAGACGGAGCTGAGCGCCTGCTGCCGGATAGAAGGTGTTTAGAGCGCACAGATTCGATCAAGAAGTATATGGACGAGTCCGGGGACCACA
TCACACTCCTGAATCTGGCCGAGGCGTTCGACGAAGCTCAAGGACGTGGCAAGGGCTTAACGTGGTGTCAAGAGCTCGACCTGTGTTTGTTGACGCCGAG
ACCTCGCGCGAGTATTTGGTCAAAACACTTGACGGCCTCAAGTTCAACATTATCGACGACAAAGAGCTAATCCAGCTGAACGGGGGCATCGAGTCAAGCA
TTCGACGCGCCTTATGTGCCGCGTACTTCGGTCATCTCGCGAGCCCTCGGGCCGACGGAACGCCGAAAGCTGGGTTTGTACGAGTTCTTGACGCTGCCAG
ACACCAGGGGACAGTGGACATGGCCGCTTACGCGCGTGCGACACCGAGATTGTTGAAGGGCCAACAATGGACTCCATGATTGCGTCCAGCATTGTAAGTT
CTCGTCGAGCACCCATAATGCGCTGCTCGGAGCTGCGGGCCTCGGCTCGTAACAAAAAGCCACCAATGGCGCACTGGAGGCGCCTCAAGCAACGCATCAC
GGCCGCACTGGGTGAGGTGCGGTCACTCACCTTCATCGTCCTCGACGACGACCGTGCCTGTCGTCGCGTGCGCTGTTGGCTCGGACGTGCGAAGGAGCCC
GTGATCATGCGCACTGTCAGCCTCCTGAGCCACGCCGACATCGCAGCCACCCTCCCGACGCTGCAGGAGTGCATCCGGCAGCTGGTGCAGTTTGTGCAGG
ACGAGCACGAGCAGTTCCTCGCCGTCCGAGCCCTGGAGCGTCGCGAGCGAGAAGATCGCCGGCAGCAAGTCCAGCAACGAGGCCAAGAGCAACTCGACGC
AGTGCGCGAGGAGCACGATCGAGTGAGAGAGCCCACTTTCGACTGGGCGGTGCTACTGGACGTACTGAGCCATTTGGTCGTGCACTCGCTGCTGGGCTCG
TTCCAGGCGTTCGCCCCGCTCTCACAGCGCCTGAGCACGGAGACGCAGCAGAGCAAGGACGCCATCTTCGGTGACCAATTTCGCGCGGTGCTACAACGCG
AGGAACTCCTGGGGATCGACGCGGCGACGCTGCAGCCCAACTCGCGGTTTCGGTCCTGGGCTTCGATGGTCGAGTGGAGCAATGTTGTGTTTGGGCACGG
CGCGGCGAGGAAGGGTGGAGGTTGAGGAAGCAGTTGAGGGGGCGAAGCTGGTGTTGTGTAGTGTTGTTGAGGTGATGCTTGTGGTTCGAGGCAAATTGAA
AAGTGATATTGAGACTTAGAGGTAAAGACTGCTATCACTGCGAGACTGGCTGACAGCAGAGGAGCTCTGCTGTCGAATCTCGGGCCCCATACACTACAAG
TAAACAAGTAATAGATCTAGAGCGCCTACAGCGCACCTCTGAATCTTGTACTTCGGCGGTGAGAGTAATCCCGTGCCGGCCGCATCAGATTCGAGTGCTC
GGTCAACGCATCCAGCTTCTCCGTTCGGACGGAGGCATTTTGTTCACAAAGAGAGATTCGCTTGCATGTGGCAAGCTGCGAAAACGCAAGGAGTGCGGCG
CAATCCTTACAAGCAACGTTCGCCCTATCGAGAACGCGCGGCAAGATGTCCGCCAGCGTCTCAACCGTGCTGACTGGGGCGTTGATCCTCAAACGCAGCA
GCGCAAGATCGACGCGTACAACACGCGTATGCAGCGCAAGCAGCGCGAAAAGGAACTTCGAGCCCAGATAAAAACTGTGAACGCGCGTTTGAAGACATCG
CGCGTG