Description :
From Genome Similarity Track
Location :
contig_60:249155- 251286
Transcript NameFunction/comments
g11196.t1hypothetical protein

Sequence
2131 bases(100 bases per row)
TTCTTCAGGCCGTTCACGTACAGCGTCGGGTACTGCATCAGCACTGCAGGAGACACGTCCTGGTTGTACATGGCAATAATCACGATCGGAATCGTCGTAA
ACAGAGCGTTGTAAAGCGTAAAGAAGATGCTGAAGTACATCAGCAAACCACTGTACATCGTCTCCATCGCCAAGAAGAAGTTAGACATCGACAGCGCCAC
GTTCTTCATGAACGAGAACAAGATCAACTTGGAAATTCTCTTGTAGCTGTAGTTGCCGTGCACCAAAAGAAGGCGCTTCAGGAAGTGAAACTCCGCGATA
GAATAGTCACTGGAAAGAACGGCTTGGCGGCCCTCTTTACCACTGATACCGACACCCACATTCGCGGCTTGAATCATCGGCACATCATTTGCGCCGTCGC
CGATAGCAAGCGTAATGTTGCCAGGTGAGAACATAAGCGTGGGTTCCGTAACCAACTTCACCACTGACGCCTTCTGGGCGGGCGAGCAGCGGCAGCAAAT
CACAGATTTACATTGCGTGGCCACTGCCAAGAAGAGGTATTTGATGTCATCATCCAGCACCAGCGCCAACGTTTTGCCATCAATAACCATAGCAAACTCC
AGTTCCTCGTCGACGTAGTCACCGCTGCTCATGCTGCCAGTACCACCCGTCATCGTATCAGTTTTAGGCTCGAAATCGTGGTCGCACAAACCACGTTCGA
AGCTGTTTTCGGAAATGTCACGGTTCGGCAGCGCAGGATACACTTCATCGAAATGGACAGGGCTGTCCGTCGGTGTCGTATCATGTTCGCGTCGTGGCAA
GCGTCTCCTCTTCTTTCGGGCCTCTGCTTCTTCGTCGCGTCCCACAAGTGCCAGTTTTACAAGATCCCACAGATACAGAATCGCTCGCTTCAACGCTTCC
CACAACACACTGAACGCCGACGAGGTCTCATCTGATCCCCATTTGTCTTCAACAAGGTCGACGTACAGTTCTTCCAGCCGAGTACGAAGCGAGCCCTTGT
CGCGCTGGCCCAGTACAATCACATCCATATTATCATCGATCACGTGTGACGACATGCCAATGCTGAGCGCTGTTTCCTTCTTGTCACCCGTGAGCACCCA
GAACTTAATACCAGCCTTGCGCAAAGCACAAATAGATTCTTCCACACCGTCCTGCAGTCGGTCTTCGATGGCTGTCGCACCGAGCAGTGTCAACTCAACC
TCAATGATAGCCGAAACCTTGGCAATTTTTGCGGCACGTCCCTCCATCGAAATTCAGCCTGTCGGTATAGGCTGCTCCACTGTTCATACTCCTCTTGGGT
AAGGCGACGCATTGCAGTGGTAAGAGTTCGAAGGCCTTCCGACGCGTACTCCTGAAGATGACCACGCGTCACATGCGCCACACCCTGTGGCTGGGTCTTG
GAAAGGAGATCGAAAATGACGTCGTCTGCACCCTTGCAGTAGAGCACAATACTACCATCGGGAAATCGTACAACCACTGACATTCGTTTCCGATCGCTGT
TGAACTCTAGCACGTTCAAAATCTCAAACGACATCAGTCTTCCTTGAATGAGAGCATTGCAAATCGGACCGTCGCGTGATTCAAGAACGTAGCCGAGGTC
ACTCGCAGCCTGTACAAGTGCCTCCTCGTCAGGGGAAGACGCATTGTATTTGATAGTTGCTGTCGGCGCCGAACAGGAGTCGCCAGTGGATGTAGGCGAT
GCGGGAACATTGGTCTCGGGTATCACGGTGTTGCAAATGGTAAGCAGTAGTAGGAAATCGTGGATCTCCTTCTTTGTCGAGTGGTTCGAATTGAGACGCG
CCATCAAGCGGTTATCATTGAACCGAGTTCCAGGTCGCGTGGGCTTTGCAGGGTCTACTTCGATGTCATTGTAGCGCAGACCAGCCACAGTACACTTCGC
AAAGATCATTTCGTTGCAAGTGAGTGTGCCTGTCTTGTCCGAGAATATATACTGAATCTGGCCAAGATCTTCGTTGATGTTGCTGTTGCGAACCTGAGCT
GGCGTATCTGTCTTGGTGTCGTACATCTCGAGATCGTTTTCAATGTAACGTGCGTGAACAAAACGCACGCCTTCCATCGTCACGTACATGGAGAGCGGGA
TCAAATTGTTGAACAGGATCACGTAACTCAA