Description :
From Genome Similarity Track
Location :
Scaffold_258:24910- 26457
Transcript NameFunction/comments
Phypl_g6073hypothetical protein PHYSODRAFT_353701

Sequence
1547 bases(100 bases per row)
ACTACACCTGCGGGGCCTCCACCATGAGGAAGCCctcgctgcactcgctgctcttggactgcagctccagtgcgTGGCCATTGCCGACGACCTTCTCGGG
CGAGACCGCGACAACATGACGCCGGGCAACGCGCGTTTCGCGGATGAAGTCGACAAGCGAAATCTGGACCAGATCATCGGCCgagaacttcttcttcggg
CTTTTCAGCACCATGATCTTCGTGTTCAGGCGGCGGTTCGCTTCGGCTGAACAAGTCACACGACGTTAGATGGCGGCCACCGATCAGACCAGACAAGGAG
AACAATAAAGGCAACGCACTTCGTGATCGCAAGCCATAAAACTGGCAGACGCTGTGAATGAGCAGTCGATGGAAcgccgagtccagcagcggcagtaTCA
ACCgcacgtccttctcgctcGCCTTCATCAGCTCAATCGGGTGTTTTAGCATGCGGAACAGCGGCGCTGCGACTTCTAATTCTGATGGCACTTCTCGCCA
CTGCAAGCACGAACTTAGCACGTGCCGTGGACCTCAATCTGTTCACGGTGTAGTTATCACCGTACCTGGATGAATTGCAAGATCACGTATTCCACAGCTT
CAATAAACGGCGCGAACGAGTTGAATGACCGCAGCATCAATGTCCGTGCACGGCGGTCCACACGAGTGAACATTTGCTCGGCATCTGCACAGTCCACCAA
CAGCCGTATTAGACAACGGCAATGCTCAGGTACAGAACGACTTAGCAGCTCACCATTCCACTCGTCTTTGCGGCGGTTGCGTGGTGCATGGGATCGGTTG
TTCTCGTGTGCGCCTCCTCCCTGGCGGAACTCCGTCTGCAGGTCTTCGTTCTGGGGCTCTGCCAGCTTCTGAAAGTTCGATCTGATATTCATCACCACAA
TTCAGTCCATTGCCTGCAGCAATAGATTGACCCTGCCAACCACCGTCTCTGTACCCACCTCCACTCGACGTTGATGTCCATATGCTCCATCAAGTCCTCC
AGccgcgtggacgccgcccgGTTGCCAAAATGGTGGTCTGCCAAGCACAAATTCCATCAGTCTTCCGCACCTAGAACCACCGCTCTCCTAAGCCTCCACC
ACTCACCGTTGaaccagcgctgctgcttgcgcacgcccagcggcagctcgttgagcttAGACAGGTACCCGGCCGAGCGGATGGGGTGGATGTTGATGAG
CCGCTTGCTGCGCGCCAGCGGCGAATCGCTGCCGCGCTTCTGCGGCGTACGCGCGCGGCTAgagccgttgccgttgctgccCGAGCGCTCCACGCCCGCG
ACGAGactcttcttggcggcgccgtcgtccgcgtcggtGCGCAGCGGCGCGATGGGGCCTTCGCCCCAGgccatctccagctccagctcgctgccgCACA
GCGAGCTCACTTCGGAGTCGCTCACGTCGGGCGCCTCGGTCGACAGCTTGATCGCGTGCTCCGCCATCGGTGCGCGGCTTATTCTCTGGTGTCGAGCTTC
CTGGAATGTGCAAGCCGTCGCCCAGAAGAAAGAGACCAACACTCATG