Description :
From Genome Similarity Track
Location :
Scaffold_20:249053- 252002
Sequence
2949 bases(100 bases per row)
GAGGATGATCAAGTCTGCATCCGCGAAGGGGAGAAACTCTTCGCCGAGGATGTGGATAACCAGATGGAGGTTCTACCGGAGGTGACAACGACCACGGAAG
ATGTGAAGTTCGAAGATATCCGGATCGAGAACGACGGTGAGAGCACACCGGAGGAAGTAGATTGCTTGAGAAAGATCATCTGGATCCGACAGCACCTGCT
GCTTGGGAAAGGGACCGCACTTCAACCCGTTGCGCGAGGCGTCGTCGTGACATTGATAAAGGAGATGCTGAGCCGGTAGACGCGTACGGAGGGTGGCACC
ACAGTTCCACGACAAGCTGTCCGACTTAATCAAGGGCCTGCTGTCCGCCAAAATTATCAGGGTGCCCAGCTCTCCATGGGCGTCGCCTATCGTGGTGATA
ATCAAGAAGAACGGTGTCGATATCAGATTCTGCATTGATTACCGCGTGGTGAATAGCCTGACGCGACTCATGGTATACCCCATGCCGCTGATCAACGATC
TGCTTGAAGACTTGGCCAAGGTGCTCTGGTATTGTTATGGCGAGCGGATTCCGGGTCGTGGAAATGACTGAGAGAGCCCGCATGGTGTCGGCCTTCATCA
CGCCGTTCGGCCTGTTCGAATGGCTGGTATGCCCTTCGGGCTGAAGAATGCGCCGAAGATCTATCAGCGACTCCTAAAGAACGCACTGTACGGCTATCTC
CGGATCCCGGAAGGCAGCGGCCAATCTGGTGCGGTAGACGTATTCCAAGCCGGCGAACCGGACTCGGATTCTGGATCGCCGGTGCTCGGCCGCCGATCGT
ACATCGATGACATCTTGGTGACGGCTGAGCCCTGAGAGTCTCTCTGCGACAGCTCCGAAGAAAGACGTGGCTAGCAGCTCGTCCATAGGGAGTTTATCGC
CCTAATTATCAGCCAGAAGTACAAGGAAACCGAGGTGTCCAGGCGCTAACGTCTCGTAAATGTTACGCCAAGTTTCGTCGCGCAAGTAGATCGACTCTTG
AATGCGTGAGACCGATGGAACCTATCGATCAGCGTGGTGAAGAGCACATGGGGTTGCGGCAAGGTAGATTACCTAGGACACCGCGTGTCCGCAGACGGCC
TCGAAGCCCACCCGAAGAACTTGGAGTCACTGACGATTCTGCCATTCCCAGGAACGTTGCGAGCACAGCCGATTCATTGAAGATCTCGCGATCTACGCCT
CGATCCTGTACAAACTGCGAGAGGTCGACTTCCACGAGATGAGCCGGAACCCTGGCTAGAAGACTGGGGACGAAGTCCAAGATGTTGAAGTCAGACTGAC
GGACGAGAAGGACAAGTGGGGCCGAGCGCAGACGGCGTTTGATATGTTGAAGAACAAGATCGCGACGGCACCCGTGCTGCGACACTTCGATCCAGATCGG
GTACCGGTGGGCGAAGTATATGCGAGCGATTGGGCGATCTCCGCAGCTTAGTGCCGGAGCACGATGGCACGTACATGCCGGTGACATTCACCAGTCGTAC
GCTGAAGCCCAACGAGCTCAACTATGGTATGGTCGAGAAAGAAATTCTGGCTCTTCTCAGGATCCTGGATGTGTGTTACTCCATGCTGGTCACGAGACCG
ATCAAGGTTCTGGCGCGGCACTCCACTCTAGCGTGGCTGATGCGATCCACAGGTCTTCAAGGCAGACTAGGCAACTGGGCCGCGCTGCTCTCCCCCTGGA
CGCTCGAGATCGTCAAGTGTACACGCGGCGAAGACGAGATCCTGGGTACGATCGCGGCGAGCATCACGCCCCGGGAAAACATCGATTCGATCTTGTCCCC
TATCGCGCCGAGGAAGCAACCACGCCAGCTGATACCTACGGTTGAACAGGGCGAAGAACTGGTAGTCGTAAGTTTCGATGGATCAGCACTAGTCAAACGA
GGCGGTGGGGCGTGTAGCGCTATTGTTTGGAAGTTACCTGAATGGATTGTCGTCGCCGCCTAATCGAAGTACTTGCCCGACCTGACAGTGAATGAGGCGG
AGTACCGAGGCCTGTTGTTAGGCTTCGATCTGCTCTTGAGCTTGGACCGGGGACGCCTGATCAAATGCGGAGACTCCAACTTGGTGATACGGTAGATCCG
AGGCGAGATAGCGTGCAAGGCACCACGCCTGACTCCTCTTCCTCGACGGGTATTAGATCGGCTGAAAACGTGGCCGGCCCACGAGTTCCTGCATGTCAAG
CGAGACTGGAACCAGAGCGCAGACAGGTTAGCTAACACCGCATTACAGCAGCAAGAAGGTACAGTGGTACCGCAGAAACAGACTGCGACGACTAGATTGT
CCTCAACCGGCTCCAGGAGCTCCTACTCCCGAAGGATGAAGGGTCTGTCGTCCGTATGGCCGCGACGACCCGATCGCGAACACGCTCGAAGAACTCGGCG
GAGGTGCTATAACTAGATGTGGTTCAACGCATCAGGACGGATCGGGTTCTGCGAGCACAGAACGAAGAAAAGTGGTTCGTAAAACTCAAGGCGTACCTGT
CAGGCAACTTGGAGAGCCTAGATGCTGGCGAAGCGCGAGCTTGCAGCAAAATCGCGGGCGACTACGACGTGGACGACGGTGGGATGCTTCTTTACTGCCC
AAGCGCAGGAAGAGATGACGGTGACCGAGATCGCTTAGCGAAGCTGGTGGTGCCGGAAGATCTACAGCAAGATGTACTTCACCATTATCACAAGAGTCTG
CAAGGAGGGCATCAAGGGGTCGGACGAACGTACCAGCGGATCAGGACGCACTTTCACTGGCGCGGTCTGTTCAAGAGTGTGCAACGATACGTGGGACAAT
GCACGGATTGTGAAACCGGGAAAGGGCGTCCGACTCTACGTGGAGAGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN