Description :
From Genome Similarity Track
Location :
Scaffold_244:24902- 26628
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_244-snap-gene-0.25Homology to unknown gene

Sequence
1726 bases(100 bases per row)
GCTGCACCTCCGTCTGCTGCTTCGTCGTTTACTGCATCTGCTTTGCTCTCGGCTTTTTCGTCGGTCTTCACCTCGCCAAGGCTTTCAAAATGGTCGGAGA
AAATGTCATCCCGCAACTGCGGACACCTTGAGAGGAGCGGTTCATAATAGAGGCGACACTGCTGGAATGACTGGCTATTCCAAAGAGCCTCAAAATCGTT
TCGTGAAGAACAACTCAGCCGAGTAGTCCCAAGCATCTTACGCAAGTACATATTagTGATGGAGTCGCAAGCTCCCGAGTTAGCCTTGCTGGCATTGTTG
AGAGCCGTGGCAATCACCATAATCGCCTTCTCGTGCAAAATAGGAAGCGGATACGACTTCACCACAAGGTGCTTTGCAGTGTCTCCGTTGTCAGTAAAAG
ATTCGACTTCATCACCTTCTTCCGGGTCGTAGTACTGAACTGCTGAACCAACCGATTGCTTAGCAGCAATCGTTCTTGTTTCAACTGAGTGCACAAGGAA
GCGGTCAACAACTGTCTTCCAGATGAGAGAATGGGTtATCGACTCCAGACTTCCGCTGTTGCCATTCGacGACTGTCCAAAGTCGCTATCGTTGCTTGAT
AGACTCGACGTGTGCGACTTGGCATCATTGAGCACAATCTCTCCTAAGGAATGCAGGAATATCCGATCTCGGAAGAGAAGATCGTCCTCAACCAGAGTCA
ACAGCTCGAGCAAATACGCAGCGAGTTCTACATGATGATCTTTGAAGCATTGGAGCACAAAAGCTTTCGTAAGGgAACGAATTGCTGAACTTGCTCGGAG
CATATTTTCCCACAATACACTATCGGACAAATCTTGCTTCAGcGATTTTGGTTCACGAGACGCCTGCATCGGATGAGTCCCCAAACCAATTCTATATGTT
GACATCGCACGAATCAGTAGCGGTAGCATGACCCGCATTGTGACGACTTGAGGAGCACGCAAAACGAAGTCTCGTTTGCGAAGCATtCTACGAACACTGG
CAGGATTTCCGATCTGGAGTAACTGAACTAGTCCTCGGCAAACCAAGTTATCAGTTGGTAGCTCCCGTTTTTGTAGACATGACACCAATGTCTTGAGCAG
AGCATCGCACAGCATTTGTTTCACGTGCGGGTCACACAGGATCATCGCAATATCAGCCAGCGTTTCCTCACAAATGCCTTCAGGCACCATACCCGTTTGA
TCCACGTCTCCAAAATCCTTAAGCGTAGTGACACCAGAACTCGTCAACATTGTCATTGCTTCAGCCGGTCCACTTTTCTTtCGTTTTTTCGCCCGAATTC
GCTGCGGTTCACCTCGGAGAGTAATTGCATTTTTCTCAATAATCTCGAGCCCACGTTTACCCACTCGCTTGCCTTCCTTGTAGAAAACGGTCGTGTCGGG
GTTGAATGTCATGCAGTTCTTAATCATGAGATTGAAGTCTTCTGTGAACATTTCCAACGTCTTATACTTGCCCTTCTTTGCCTTCTTTCGCATGGTGGAC
AAGTCCATTGGTTCTTTGATAATGTCTCGATAGTTTGGTACATCATCAGGGACTGGTTCAGCAAAaATCATGCGAGCATCCACCTTCGCAATTTTGTCCA
GTACAATCAGCAACTGATCAACTGGCGGTGGGCCAAGCACGATCTCAAAGTTATCTTCCTCTTCCTGAATCTCCGACTTCTTCTTGAATTTCTTGTTGAG
AGGAACATCACCAGTTCGTAGCCTCT