Description :
From Genome Similarity Track
Location :
Scaffold_66:24902- 25909
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G014583Similar to VSR4: Vacuolar-sorting receptor 4 (Arabidopsis thaliana)

Sequence
1007 bases(100 bases per row)
ATCCGCGAGGGCTCTTCGCAGCAGCGCGCTCCGCTGGGTGCATGCGGTGTCCATCGTAGTCGTCGTCATCAACATCGTCCAAAAGCCCCTGGTCTTCCAA
CGGCATGTACTCGGCGAGAATGCTACGCACTTGTTCACGCATGTGTCGTTGCGTCCGACGCCAATAAATGAACCCAGCAGCCGACACAGTTCCCGCGACG
AACATCATAATCACCATCACCGAGCCAAACGAATAGCCTCCGCCACCACCAATCGCGGCATTCGAGATTCCACCCGCTTTCACACAATCCTGGAGTCCCA
TTGGGCTTTGGTTCGCGCAGGTACAAATCTCAGGCGGATCATGCGTGCCATAGCCCGCACAGATCATACCCAAGATACTCGTTGGGTCGACTCGGCCGCG
AGCGTGAACACCGTCGACGTACAGAGCTGGAAGGCGGAGCAGTTGCAATGCGGTTTGCTCCTTCAATTCTTCTTCCAAAAGCGGGTTCTTCTTATCGACG
TCCATTCCATACGGTTGCATGCACTTTTCGACTGCGTGAATATCGATTCCATGCTTACGCATGATCTTTTCTGCGCACGTTCGCTCTTTGAAGACATTTT
CGTCTTGTCCGCACTCGACACCCGACTCCTTTACGTACTTCCACCACTTGAGTCCAACACCAGGATCTTCTTTCGACGCGATGTTCCAAATGCATTTGCG
TCGCAAATTCTCAATGACAACATCAGCTCCGGAAGCGCCACTACCGCGATCGTGGAAGGGCGAAGGATCCAAAAGACAGTAGCGTCCCTTGTTCAAGCAC
ATGTTGCCACATGCCTGCGAGAAGTCGCCATCATCGTAATGACATCCCACTTTCGAGCCATTGTACGACACAAAGCGAGGCGTGAAGAAAGCGCGGCTGC
CCAGAGTCGTCACGATCTCTTCCAGCTTCGACAACGTCGCCAAACTTTGGTCGTCCCAAGCGCTTTGCCACAAGGTCCATTCCACACGGCCATCAGGGGA
CGGGATG