Description :
From Genome Similarity Track
Location :
Scaffold_1602:2490- 4382
Sequence
1892 bases(100 bases per row)
ATTCACCAGAGGCCGCTCCGTGGGGTCTAATATTCTTGATACCGTGGGCTCGGGTTTCAATTCTTTTTGCTCGCGGTCGCGCATGTGCTGGCGAATACAC
TGCGTGTCTAACGCTCTGTCTGAGGTCATCTTATTACGCTTTGGAGTATGAATCATTCCGATTTCACTAAACAATCTTTCAGTGGTAGCAGTATTTACTG
CAATCGATAACAATCTAATTGCCGAATCCGGTAGTAGACTCATCGAGCAATCTTTTTTCACGTTTTTCCAATAGCGAACGACGTCATACCGAAAATCNTC
GAGCAATCTTTTTTCACGTTTTTCCAAAAGCGAACGACGTCATACCGAAACTCCTTCGGATTCAGAGAAGTGAGTGTGTTATCAATCTAATCCGAAAGGT
TACTACGAATACAATCGTAGTCAGCGCCAATAAGTCGACGGTAGTAGTAAACCGCAAACCTACCCATCTGTGTTGAGGTAGCAATCTTTGCAGCGGTTTT
GCTTGCCCGTAGTTGTTTTAGGCTTTCACTTTCCATACGgccgtcttcaacttctACACCCCTTCCGATAACACgttcctccacctccaccatgcgCTTG
CGTTCATCAGTATGCTCAATTAATTTTCTAGCATCATCCGCTGTTGTTGGATTTAGCAAAAACGTCAACATAAAAAGCGGTTGTTCGCATTGTCTCCATC
TGTCCTCCACACACTTTACCAATTCACTTCGACAATCCAAACGTGTCCCGTTGAATCCCACAAAAATATCACGAAAAGATAAAACCGCATCAGCTAGCGT
ATTCTCATCGCGCTGTAGACGGTATGACGCTTCCGATAACGGAGCGATGACATTCTCAGCGTCCGTAAGCCTTTCCCAAAAGATGGGATCATCGAATACT
CTTAGAGGACTAGGGAAATCCTGTCGGGGACCGTACATGCTGCTGAACGTCTTCAGAGCTGTTCTGACTCTCANAAATAGCGCTAGAGGTGTCTTGTAGC
AATCTTTCATCATATCTCTCGCCACCACTTACCACTTTGCCGACGACGCATTCAAACACTTTACCGCAGCCGTTGCATCTTTTGCAATATCTGCAAAAGA
AGACTTCAGCACGGCCTTCACAATATCGTTGATGCAATGCGCAAAGCAAAAGAGAAGGGCCATGTTTGGCCGACGAAGCGCCAAAATGCGACGAGCCCGT
GCGCATTCCCCACTNCTTGAAATATTCTGAAATACATCAGACAGAAAATTTACAAAACCACCTGGTTTGGCTTGTTTCTCCTTTAATTTTTCGGCTTGCT
TTCCGCGACAATACGCTGCATGTTCCCTTGTTATGCGGCCGCCAAGTACTCGTCTCGATGGAAGGTAGGCAGAAATACCCGGACAGAGAAGTTCAACAAA
GTCAATAGCACACGATCGCTCGATAAACATGTCCGGCAGGAAGTTTCCGGCTTGGAACTCAACTAGTCGACGCTCCAACTcttgcttctgcagcttcgta
aACCTTCGGTGCGGTTTCCGCTTCGGCGATCCACGCTTTGATGTGCTTCCCCGAGGTGACTTTGTTGTGAAAACAAGACGCTTATTCACAGAGCGCCTAC
GTCGATTAGCGGACCCTGTACTTGACGCACTACTATCCTCGCTTGGCAGTCGCGATGCTCCGGCGGCAGCTTTGTAGAACTCGCATTTCGATAAATGACG
AACATAGTTGTACGGACGGCCCAAAAACAACTGTGGTGTCCCCACACTTGGGTCCTTgtcaaaagctgcagtgcagaAGTTGCATGTGTAGTAATCGTAT
CGGCCCTTACTCTTAGGCACATCTGCTCTTTTGGTAAAGCTGTCCCGCTCCGGAACATGATTCCGCCCCATTGTACAGGGAGAAGTAAACGA