Description :
From Genome Similarity Track
Location :
Scaffold_226:249- 6744
Transcript NameFunction/comments
Hyaar_Emoy2812912hypothetical protein

Sequence
6495 bases(100 bases per row)
GAAAATACGTTTTGTATTAAAAGTAAAAAAACATCTATCAAACGCTTTTATTCGGGAAATGGGAAAAGGGCGGGACGGCGATCACTGTTCAGTCGTCAAC
AATATCGATCTAGTTGTCGCTAAACAATAGGAAGTCGAGAACATTATCAGGTAGTTTCATGTCGCGCAGATGACTCGCCAAGAGGTCCTGTTCGACCAGC
TCCGAGTCGTCGAGTATTTCATCGACAGGACGATGTGCCTACCATTGTCGTCTGCTCCACCATTGTCGTGTTCGCGTCAGACAGACCATAACAGGTCTTT
GTCAAAGAACAGAACAGTTTTGAAGTGTTCAGATCTGTTCCGTAGAGAGGAATTGAAGCCGGAACAGATATGTTAGAACATCTGCTGATTGGGAGGTAGG
ACACGCCACGAAGTCGCGCTGTCGTATGCCACAGCAACTTGACGTTCGATAATGCCTCTTTCAGCAAAGTTTTTTTTTACCGGTGTCGACTTGTTCGTGC
TGCAAATGAGACTGGTTCCAGTGCACTGCGTCACGTAAATGCGGAACTGATTGGAGATAATGTGTTGCAGCAAATTTAGCACAAATATACGGTGATTATC
TTTGCTTGCTGTACGAGGTAAGCAAGCAGTAACATGATCAGTTTGCGATAATGTGTCTCCATCGTATCTCACGCAACAATGTTCTTGATTCTGAATACGA
GCCAAAGAGGTACAAGGTGTGAATGGGCATTTGACGACGCTGTACAAAGAGCTCTTGGGGCGTCACAGACCTGCCGGGCCAACGGCGAGGAAAAAAATTC
AACGTCGATAAGCGACAGAGGATATAGCGTCGGTCCAGCATTAATAATGGAATGGCGAATCAAATCGCCATTTTGGTAAAGAGATTGGAATGAATTTGGC
AGCTGCTTGCAAGGTGGAATTGCAAGTATCATATGCCTAACTGAAGCATGACATAACTATGACTGATTATAGATGACGATCAAGATCGAAGAAAAAATAC
AACTGACAAATGTCCAGTGCGATATATCGGAGAATCTTTCTACAATCCGCGACCCATGGATTGCGTATCATTGGGTATACCAGGTGTATAAATACGGTAA
GAACACATGGTAATTGCTTAATCGACACGCGACATGAGTCAGTTAAGGATATGTGTAATCATGGATGATACGCGATTGCGATCCCAAGATTCTCGATAAC
ACGAAGAAGAGATCGCAAGACGTTTTGCGGAGTACGTAACTGATATGTACCACATTACGGATGATACGCGATCACGATACCGTAATCTGCGACCTGTGGA
TCCACGATCTATGTTTTGCAATCCATCCGTTTATGCACCTGATGTGGACCACATGTTACAAGGGGATGATTATCATGAAGGTAAGACGCGTGGCATCGTA
TCCTGAAATGAAGATATGCGTTTTCGTAGGTTTAAGGTTTTGGTAGGTTAACATCAAACAGATTTCAAATTAGTTCTAAACACACGGGTCAACTTATCTC
TCGGGCTGGATGTTTTAGCCTTTCGACGTAAAGAAAGTTTGAATACTGTAATCAAGTGATATCCCCAGATTACTTGGCTGGGGGTCAAGAAACCTCCAGC
CAATCCCAACTACGGTAGGACGCAGCATCAAAGTAAAGGACACGGTTCAAGATCGCGAGACGGCTCAAGTGGTCAAAAAAAAGGTCAAGCGGATCAAGTA
TCTACATTTGGACAAGGCAATCTCAAGGGAGATTCGCGCAACTCGAATCAAGTCCCCCAGGAAGACCGCGATCGCGTAAAAATTTCCACGTGATCGCCCA
CCCCATTCCAACTCAGTCAGCTTTCCCCTCAACACGAGTCCACCGAAAAGAGTTGAACCCGCTCTACTGACGGGTACATAATGTGAGGATGGAAACAAGC
ACGCAAACGGAGAACCCCCTCTGAAAGTTGGTCGTCTGGTCGCTAGAGGATAGTCGGTATCGCATCGGCAGCTTTGCGAACCCACTCCACCACACCCTTA
TGAGTTAGCTGGCCGCAGTGGAGTACAGGAACACACCACCGTTACCTGCGCCGACAAAGAACTCTTGGCCAAGTAGAATAAGCACTGGTACTCGCGGTAA
CAGTGAAGGAGCAGACGCAATGGAAATTGATGAAGTATGAGACAATTTTGGATGGAAGACCAGAATACGGAAAGAGGGTCAGCGTACTGAGCGGCGTTGC
TTTGAGACAAGAGAAGCAGCGTCACTGCGAATATTACAGGCAAGCAGAAGAACGTCACAGAAGACGAGATGCAAGCGTGCCTGCATGAGGACCATGTCCA
AGACCATCGGGGGCAGAGGAAAGAGTACGCGCTGCATGGCAGCATGTACCATGAAGCCAACTGCCCAAGCGCATCAAACGGCTGCATAAAATGAATAAGC
GGTTGTTTAGGCTCGAGAGACGGCAGTAATACACGGAAAGTATACAACTGAGAGAAACGAACTTCTGCGACAGCACAAAGTTCAGGCAAATGTCGTAAGG
AGCCGGGAAGCCACCCTGGAGAGGCAGAGAGCACTAGCCGAAAGGACAAGAAGAGCACAAGTTAATCTTGAATCACAGTTTGATGCAGAAGAACAGGCCA
AGCGTGAGGTAAAGTTGACGGACACACAGATAGAGCAGCAAATCAAGGAGGCTGAAGAAAGAGGGTTCAGGAGAAAAACGGTTGTCAAGCGAGAAAAAGT
ATCCACGTCAGCCACTGACCCTCAAGTTTCTCTGATACCTGTTCTGTAACCAAAGAAAGACCCATCATTTAAGAGACAAGACGCCGACGATCGAATCCAT
CTGATGGGGTCCCCAGGAACTTTTCGCTGTCGAGAAGACCCCGCTGGATTTTCTTACCAGTTTTCAAACCCCCCAACGTCCGCCATCACTACAGTCTCTT
CATATCATGACGAATGATGACAATATGCAGCAACATACTAATGCTTCGCTTATCAGGTTTTACAGGCTGACTGGCAAACAAGTGCGGACACTACGTCCCT
ATGAAGCAGCTGAGAAATTGTCATGCTGACTCATAGGTTGCAAAAATACCGCAGTGTACATAGTCTGTGAGTATCCATGCACACAAGCGCCCTGCAGTCA
ATGATTTACACTGGAGTGGTGAAAGCACGGACTACCGTGAGGTGACAAGGTAGCAAAGCCATTGTTTTAGCCGCAAGTACCTAATAAAACCCTAAGGGCT
TTGCCTACGCTTGTAAAACCGTTTCACAGCGTCACCCATGCCCAAGGACCAAATTCGACAGCATGCGGTTCGTGCTTTTAGTTGCACCTGTGGAGCGAAA
TGCGTCGGTAATCCGTAAAAAAAATTGTCCAGCATCGAGCGTATATAGATACTGATAGATCGATCTTTGACAGAAACATCATCTCGAACAGTAGGAACAA
ACACTTTGTCCCACTATCTAGCAAGTTTGATGTTATTTCGTTGTTCTTTGCAGACTAGTTTCATTCAAGGATGAACAGAGGAAACGTTTTTGTGAAATTA
CCTGTGTCTTTTTGAATGCTGCATGAGCACTGTCAACTTTTGGTATGAGGAATTTTCCAAAATGCAGCACAAAATTGTAGGGTATACACCTGCTACTTTC
AACGTAATCAGGCACATTATTGGAATATGCCCTCTCTTATCATGCCACTCTTCTTTTTTACATCGGTCTTGGTTAACTCATATTCATGACTAGCGCGACC
ACATCTTCAACATACAGGAAACGTTCACTGGGTACCTCCCTCTACCCCAATGGAAGAATAAACTCTTATGTGGCAGTCACTGATATCGCTTTGTATTTGT
CTACAGCAAAGTTGATAGTGAGCTTGGGAAAATCTGCACCAAAAGCATTTATCACGGCCTGGTCAACATCGGTAAGAATAACTCCGGGATTGATGATAAT
GCTCTGTTCTTAACGAATCTGAAGAATCCATATCATGTCCACTTGTGTCGCGCTCTAAGGGAAGCAAATGCCAATGTGTACGGAACATTTGTACTGGGTG
GTGAAATCACATGATGCATGCCTGCTCCATATTTGTTCGTGTGGTGTGTTTCGTTTAACTGCTCCACATATCTATGGCGTTATTCCAAAAGCACCTGAGG
GATGCTACTAGAAATTACAAGCAAGTGAGTAATTTGTAATTCCGAAGAAAATTTTGTTGTAAAAAACCCCTCAATGTCAGGAATTCCACCTCTCTGCTTT
GACGATATTTTTACGCATATTCATGATGTCCAATGCAATCAATCCACACAACCGATTATACTTAGCCTCGAGATTCTCGAGCATCGATGAAGAAATTGTC
CGGGCTTTAATAAAAAATTAATAACAAACACGGCAGCGTGACGCACACTAGGGTGATGACATATATTATGTATTGGGGGTTGGTTATGCTACCCATCCAC
GGCAATTTACTAAGTGATACCGCATAAGTCGATTCCAGACGACTATCGCAACTGTTAAACGACTCCGGGGGTTTCTTTAATTACGCGATCGTTGCTGCCA
GATTTATCGTTGCCACAGAGGATGTAGTAAGTCTTCCTAAACAATTTTGCAGTCTGGATTCTGACTTTATCCGCCGCTCTCTTCTGATTATGTTGCTTCT
TTATCTTAGGCACGAATCCTCTGTAACCACAGCCTTTTTCTAAGAGCTTTAAAAAGCAGCGTCGGGGCTTACAAATCTTGGACCATTAAGTGGTCATGCA
GCTTGTCTTTCTTGGTGTACAAGAGGTAATTCATGGGTGGCTAAAGTGTCCGGTTCCGCTTTCTTCTCCGGGTCCAGACCAGCTTAATTATCGGCATTCT
GCATTGACTATTTGATTGGTGTCCATATGGTCTTTCACTTCGCCCTTCAACGACTAAACTGGAGATCGATGTCGTCACCATGAGCAATAGACGATTTATG
TAACGGGGCACACTTTATTCAACTAACTGAATAAACCTTGCACTGCTGACAGTGCAAGGGTGTGTGCGTCCGACTACCTCACGTACACGTGCGTGCAGAG
GAAGATTGCTATACGGAGTAAGATTACTCAGTAAAGGTAAAAAGTAGAACTGTACTTAGTATAGTTAACCATTTTAATAAATCCCTATTTGACTTCATTT
AACTATGTCTAAATACAAACATGTATTGTAACTATCTGCGCACCACTCATTGCGTGATTCTGTCGTGGCTAGACTTTATTGGTTGATATCTCGATCCTTT
AACATCCAATGAGCAGTGTGTTACATCTGCGAGGCAATATTATCTATTAGGATAATACTGTGAGAATATTGTGTTTGTCCTAACGCAATATTCGTACTTG
ATAATTACCTTATGTAAATTATCATGTAACGGGGGCACACTGTTACATCACCATCCCCCCTAACCATCAGTCACATTAGTGACTGATTGATGATTGAATG
ACTCTTTTGGGTGGCTCTGGGACAGGGAAGCACTTGTTGGCCAATCCATCCATTCTTCATTCTCATCGCATGGTTAACAAGTCCATGCGGTGTGCAGCCA
AAGCTGCCGAGTACGCAGCCATGAGACTCCGCTCTGCTGCCGCAGGGGAGACAGGATCACCCGAAGCAGCTGACGTAAGTTCTTCTGCTGCTTCCGCAAC
TCAGCCTGCAGCAGTCGCACGCGGTGATGCACCGCGTGACATCGGAGATTATGAGCTTGAGCTCATATACTCTGGCGAGTCTGACGGTAAAACCGACTCG
AAGGAGGCGAAAGCCAAGGAAGAGCCAGATTTGGCTAAACCGGAGCCGATTAAGTCGGCTTCTCGAAGCGCTTTAAGCCTTGAGGATCGTCGTGACATCT
TCGAATCCGACGAGTCCGACCCTCCGTCTCCGGGACGGAGTCGTTCTACCGAAAGCGAGTTAAGCCATCGGAACGACTGTGACGGTGATGCAATCATGCA
TCATAGTCCGAGTGATCGGGATGATCCTGGTGTCGGTACTTCTATTTTTCACCAGACAAGAGACTGTGGATCGCAACATCTTGCGTGTTGCTCCCGAGAA
GAAGCCGTGGCTACCTCCACAGAGAGTGTTGGCTCGTCCGTCTGACACGGCGAGTGATCGTTATCGAATAAAGTTATTCGATTCATCAAAGCTTCATAAG
CTTGATCCTAGTGCGAGTAACTTTCGCACTGAATATGATTTCTTCATCGATGCGTTCTTCAAGCATCGATGGTACAGTGGGAGTCACAAGCGTGATGGTC
CCTCATTGATTCAGGCATGGAACGCTTTCATCCACAACGTTGGTGAGATTGGGCGTGATGCCTGGCTAGACAAGCTATTGCTAGCTCGAAATCGTTTTGA
GAAACGGACCTCTACTGGTGCACGTTTCAAACTGCATCGGTTGTCAAGAGATGCCGGGCTACCATGCCTCTCTTGGGGTGATGCGTGCCAAAGTTGTGTG
AATAACTTGGCACGAGCTCCAAAGGAAGCGTACTCGATGTAACCCCTGGTGGAGGGTACGTGTCACTCAAGAGATGTGCGAGGGAATAGCTAATT