Description :
From Genome Similarity Track
Location :
Scaffold_207:249- 4498
Sequence
4249 bases(100 bases per row)
ACGTCACTCTTATGCATAAACATTCACTCCTTCCTCCTAATCCACCCTTCCCCTGTGGATTCGTTTTCTCTTTCTTTCCGATGTGACCAACTCACATCAG
CGATCCTCCTCCTCCTGACCCACACCCTTCCTGTGGGTCCTTCTTCATCCTCCCATCGACATGACCAACTCACATCCATGGATCCCCTTCCTACTCTTCT
TCATGAGACTGCATCACGCCGAATCTGTTACGATTCGTACGATCCGGCAAGAAATCATAGAGTAATGCTCCACAGTTCAGATCTGTCTCGTCTACCCAAC
TGGGTTCGTCATATCCACGCCAATACACCAGAAATTCACGGTAAATCCGCCCGTATCTAGTTCGCTTCCCTGACCTCATGTCGGTGATCTTCTCGACTTC
GAACTCGTCGGGCCTCGAGGTCCACATTCCAACTATCCTCCGGTAGGAGGACTTCGTCGAAGTCGACCCGGTCGGATCCATCCACCGAAAGACGGGTTCG
CGGCCGATCCGGATATTCTTTGACCAACTTCAGCTTGGATACGTGTACTACAGGGAACAGGCGATATTCGGTACCTGCCGTTTCCAGCTTTACCGCATGT
TCTCCTATCTTTTCGCTCACCCGGAACGGTCCATGCCATAGATGGGCCAATTTGCGGGCGTACCCTTCTTTCACTCGATCCAAATAAAGCCACACCTGCG
ATCCCACTTGGATTTGATGTGGACGGGCGTCTTCGTTGTGTCGATCCGCTCGATCATGTATCGCACTCCGCAGTCGTTCGTTCACTTGGGATCTGGCTTG
CCGGTAGTATTTCTGGACTTGGTATCGCCATCGCCTTGGATCTCGGTTTCTCTTCTTGGTGCTACATACTGGAATGGCCGCTTCTAGGGTGGATTTGGGA
TCCCACTCATGTACCAAGTAAAATGGGGTATCACCCCGGATCCTGTCTTGGGCGGTGTTCATCGCGAAGGGGGGTCGTTTTGCGTACTCATCCCAATCCC
TCTGATCCAAATCCTGGACATACATCTTGAGTGCCCTCGTGATCGTCTGCACCATGCGCTCGGCCGACCCGTTAGCTTGGGGACGATATGCCATGGTTGC
CCGCTGTCTCTGTCCCAGGATCCGGTTGAAGGCTCGAAAGAAATCAGACATAAAGCCTGGCTCCCGATCATGCCGAATCATCTCACTAGCCCCAAATCTT
CAAAAACCGCACTCCTCGTACGATTCGGCATGGTTTGCGCAGTTCTAGACGCACTAGCTTTGGCTATCACGTATCCGGTAAACAGATCCACACAAATCAA
CAATTCTGTGTTTCCTTTGAACGACTTGGGCAACGAGGGGATATGATCCATGGCTATGATTTGGAAACGGTAAGTCGCTTGGACATTCCCAGGTGACTCC
CCTTCGATTGTGGGCCTGCCCTTGCCTGTCTCACAATCCACGCATTCACCGACATATCGTTGTACGCTCTTGAATAGTCCTCTCCAGTGGAAACATTCCC
GGATCCGTTGGTAGGTCCGACCAATTCCCTAATGTCCACCTTCTAAAACTAAACGGGAAGGGGGGGGGTTGGGGGAGGCTCTCGGTGTGCAAGGTTTTTC
CGGCATTACTCGCTTTTCACCACAACCCATTCGCAACTCGCCTGAAATTCTTTTGCTAGGGGGAAAAAAAAAAAAAAAAAACTTTCCAAATTAATGCCCA
AATCGCTAAAGCATATAAATGTCTAGGAATTGGTTATTCCCGCATTCAGTCCGTACATCCCCATCGATATCTCTTATCCCAGATCACGCTCTCGTCTGTG
CTTTAGGATCGTCATGCGGACTCCTTCACAAATGTTTCATCGAGGATCTGGGGGCTGGATCCAATCCTTTCTCTGGACCTAGTGACAGCCATTACCTGGA
CTGTCCTTTTCCTGGATCCAACCACCACCACCTCATCTAGTCGGTTCAACGTAACGAGATCCTGATGCTCGGTCTCTTTCTCCACTTCGACACCACATTG
AGTCCGTAAAGCGGCACTGGCCAAGCTATCTGCACTGGCATTCCAATCTCGCTTGACATGCACCAACTCGTGATTCATCCAACCACGCAGGTGGATCATC
ACTTTCTGCCGTAACAGTGTTAGGGCCGGGGCCTTGCAGTCAATCTCACCTCGTACCTGTCTGATCACCAAGTTTGAATCCCCACAAATCACCAGCCTTT
TTGGATCTTGTCCCTTTAGTAGATCCAAACCCAGCAGTAGCCCGTATACTCCGCTTCGCTGACGGTGAGGCCTTCCGCATAAGTGGATCTGGCCCGTACA
ACTTTCCATCCAGGTAGTCTCCACAGTATCGCACTGTACGCCCCGCCTCCGCGTCGTACGCGAGCGGATCCATCGAAACTCAGGACGTACAGATCCTCGT
CTGCCTGTACCGTCGGGATCGGGATCTGGATCCGGCGTTTGAGCTCTTTCTTAGGAGCGACCCTAGTCAGCGCCTCATCCATCTTAGCTCGAGGAGTGAT
GCTCGCGGCCAAGACTCCCAGGATCTCGTCTTCCCCTTTCGAACATTTCACAATCTCCAGTGTCCAAGGCGAGAGTAAAGCTGCCCACTGGTCCAAACGT
CCTTGTAACCCGGCCGACTTGAACAGCCAGGCTAGCGTAGAGTGTCGAGTCAGGATCCGAATGGATCTTCCCACCAGCAGGTTGTAATTGAGATCTAACA
CCCGTAGGAGTACGAGTATTCCCTTCTCCACCGCTCCGTAATTCAGCTCATTCGGCTTTAGCGTTCGGCTGACGAAGGTTACTGGATGGTAGATCCCCTC
ATGTTCCTGTACCAAGGCTGCTGAGACTACCCAGTCACTGGCATAAACTGTCACCGTAGGTTGACGTTCCGGATCGAAATGGCGGAGGATTGGCATCGTC
GCGATTCTGCTCCTTAGCTCCACAAACGCGTGCTGAGCTCGGATCCACCGAGGCTCCACCTTCTCCGAGTTCCCCTCAGCTCTGTCCAGATTGGATCCTC
TCCCAATTGGTCCCGGGGCGGATCCAGCTCCTGTTTTCGGTCCTCTTCTGGCGTCGTACTACTTGAATCCCTTCGTGGATCCGACATCTCCAGGGCCAGA
GCTTGTTGGATTTTGATCCGGACAGCTGGAGTGGTCATCGCAGCAAAATCTACCTCTCTCAATTCATATAGTACCGCAGCAAACAGTGCGTAATCCTCGA
TGAACCGACTGTAGTAATTCAAACTGCCCAAGAAGGATTGCATCGCCCGTAACGACTGTGGGGAGGACAAGTCGGCTAAAGAAGACAGGTCCTTAGGATT
CGCCTCCAATCCCTCCTTGGAGACTCGATGGCCTAAGTAATCCACCTTGCGCATCCCCCAATAGCTCTTCACCACACTGATAGAGAGATTCCACTTAGTA
CACGCCTCCAGTAGGGATGTCACGCTTTCGCACAACTGATCCCACGATTCCGCCGGGATTCGAATGTCGTCGATATAAGATCTGCGTCCTAACACAGACG
GGGTCCCAGGATCCCATGGCTCCCCCGCTTCGAATGGATCCACTTCCGTATGGTCTTCCCTTGATCCACCCTTTTCGGGTTCCAATATTCGGGTGAATCC
ATAGAGGGCGTTATCGATCAGGCGTTGGTAGATCTGGGGTGCGTTCTTCAATCCAAACGGCATCCGGTTCCACTCCAACAGTCCAAACGGTGTGATGAAT
GCGGATATCGCGCGAGCTCGATCCGTCATAGTATCCACCCAGAAACCACTGGCCATGTCTAGAGAACAGTACCAGAGTACTTTATCCAAATCTTCCAACA
GCTCATTGATTAGAGGCATCGGATACACCATCAATCGAGTCAGGCCGTTAACTAACCGGTAATCAATGCACAGACGTATAACCACCCCGTTCTTCTTGAT
GATGATTACCACCGGAGATGCCCACGGGGATGTCGAGAAACTGATGATCTTGGCTTGCAGCAGGCCCTTAATCAGATCTGATAGTTTTTCTCGGAACTGA
GGTGCCACCTTCCGCACCCTTTGAGCGATCGGTTTCGCGTCGCCGACATTGATGTCACATTTGACTCCGCGGGCGGCGGGCGGTAATGCATTACCTTTAC
CAATCAGCAAATGTCGGCTTTCCCAGATTTTCTGACGTAACCGATCCACTTCCGCGGGCTCGTTTGCCCCTGGATCCACTTGGATATCGTCAATTGTGAC
CTCCTCTGTGGTCAGTGGCACCTCCGGGATTACCGCCAGGCCATCCCCG