Description :
From Genome Similarity Track
Location :
Scaffold_1306:249- 3537
Transcript NameFunction/comments
Phyin_T30-4PITG_23223Putative uncharacterized protein

Sequence
3288 bases(100 bases per row)
TCGGCTGCGAAAACGGCTGCGCAGCGCATCTCCTGCTTCTGGTGTTGGATCTGTGGTGAAGTGCTTTTTCAGAAATAAGAGAATGGACCCGACGCGGGGG
TCACTATCCCGAATCAGTGACAATTTCAAGTGATTAGAGTGGATTTGGGTTGTCTGGCACGGATGCAAGTTGCCTGTGGTGGATTAGCCATGACGAGCAA
CACCCCGTACGAAATGACGATGGATCTGGTATGAGTGATGTACGGCAAGGCAAGATCCACCAAGACTTATCTCGGATCCACCCTTACCTGGATTCACTTA
GGTGGATATGGGATATACTATGTACCAGTGGATCGAGTGTGGATCCTATGAAGGAATGGTGGTAGGTGCCATCTGAAGGTGGATCTAGTAGCCACGGCTA
ACAAGAAGTTAGGATCCACCGCGAGGTACCCCGGATCTCATATTCCCGAGTTCGGATCCAAGGAGGGAGGATCCCGCATAGAGGGACCTAGATCCAGGGT
ATAGGGATGATGGATGCAGTGGATCTCGAACTTTCGTGGGACAATGGAGATCATAGACGGTTGCGAGATGATGTTGGATAATTGGAGAGCTCCGATCCAC
GACGAGTGTACACTTACAGTGAAGTGGATCCAAGCGACCTGGATCCGGATGAGTGTACCCATAATAGTGTGACCATAATGATTACGCCATGGATTCGGTG
GATCTGAAGATAATACAGCTGGGATGATGGGTCAAGGAAAGAAGGGACATGCAGCCGAGCCTGGTAAGGGATTTAACGAGTGAAAGACATAGAAGGTAGA
AATCCAGGCAGGTATAGGCTTAAGTATCAATACAGAACCCAGTTTGCACAGTAACACGCAAGTGCCTTCCTGCCCTCAAGAACCGGAACTACATTGGCCG
TACGAGCTCGGAGAAGGTTGGAGATTGCGAATCTAGTGTTGGTAGCGATAACTGGATAGTACATTGCCCAGATCCTACAACCTAGTAAGCTTTTCCTTTA
CTTGTGCAGATCCGACAGGTCTACCGAATTTACTACTTGGTCGGTTACACCCTAGAGGTTCTCAACTCTCAAGATCCCGTCACAGGAGGCGGCAAGTACG
ACGCAAAGGAACTACAAAGGCAAGGGAACACACCCGCAAGGCAACCCTACGGCCAGATCCACGATCTAGGCCCCGGATCCATAAGCTCGAATATTCGCTT
AGGATTCGGAACCATCCACGGACGCAGAGTGAAGATTTTCCACTGCTGCTCCACCCCATCCCCACGTCTCGCCAAGACGCTCAAGCTTCACCACTTAAAA
TCTTCGGAAGTTACCGAGAGAGCAAGATCCCGCCCTACCGACGGGTACACAAGGTGAGGAAAGTTCAGCAGAACACGGATCATCGGGGGACCCCCTCCGT
TAGTCGGTGTCTGGGCGCAGTTGGTAAGTTGGTTCCAGCAATCTCGCAGATTTTGCTGATCCCGCTACACCACACCTGTCTTCGTTAAACGACTTGTCCT
TCCCACAGTCGTTACGGGCGACGCAATCCTTCTTGGGCAGTTTGTATTACTACAGTCGGTTCATCGAGAACTACGCACTGTTTGCTGCGGTACTATATGA
ATTGAGAGAGGTAGATTTTGCTGCGATGACCACTCCAGCTGTCCGGATCAAAATCCAACAAGCTCTGGTCCTGGAGATGTCGGATCCACGAAGGGATCCA
AGTAGTACGACGCCAGAAGAGGACCTAAAACAGGAGCTGGATCCGCCCCGGGATCAAATGAAAGAGGATCCAATCAGGATAGAGACGACGGATCAGAGCT
CGGAAAAGGCGGAACCTCGGTGTATCCGAGCTCAACACGCATTCGTGGAGCTGAGGAACAGGATCGCGACCACACCTATCCTCCGTCATTTCGATCCGGA
ACGTCAACCTACGGTGATAGTTTATGCCAGTGACTGGGCAGTCTCAGCAGCGGTGGTACAAGAACATGAAGGGATCTGTCATCCAGTCACCTTCGTCAGC
CGGACACTGAAGCCGAATGAACTGAACTACGGAGCGGTGGAGAAAGAGATACTCGCGCTCCTGCGCGTGTTGGATCTATATTACAACCTGCTGGTGGGAA
GATCCACCGGATCCTGACCCGACACTCTACGCTAGCTTGGCTGTTCAAGTCGGCCGGGTTACAAGGACGTTTGGGACAGTGGGCAGCTTTACTCTCGCCT
TGGACACTGGAGATTGTGAAATGCTCGAAAGGGGAAGACGAGATCGTGGGAGTCTTGGCCGCGAGCATCACACCTCGAGCTAAGATGGATGAGGCGCTGA
CTAGGATCGCTCCTAAAAAAGAGCCCAAACGCCGGATCCAGATCCCGATCCCGACGGTACAGGCAGACGAGGATCTGTACGTCCTGAGTGTCGATGGATC
CGCTCGCGTACGACGCGGAGGCGGGGCGTACAGTGCGATAGTGTGGAGACTACCTGGATGGGAAGTTGTACGGGCCTGATCCACTTATGCGGAAGGCCTC
ACCGTCAACAAAGCGGAGTATAACGGGCTACTGCTGGGTTTGGATCTACTAAAGGGACAAGATCCGAAAAGGCTGGTGATTTGTGGGGATTCAAATTCGG
TGATCAGACAGGTGCGAGGTGAGATTGACTGCAAGGCCCCGGCCCTAACATTGTTACGGCAGAAAGTAATGATCCACCTGCGGGGTTGGATGAATCACGA
GTTGGTGCATGTCAAGCGAGATTGGAATGCCAGTGCAGATAGCTTGGCCAGCGCCGCTTTACGGAATCAATGTGGTGTTGAAGTGGAGAGAGAGGCCGAG
CATCAGGTTCTCGTTACGTTGAACCGACTAGACGAAGTGGTGGTAGTGGGATCCGGGAAAAGGACAGTCCACGTGATGGCCGTCACTAGGTCCAGAGGAA
GGATTGGATCCAACCCCCAAATTCTCGAGGAAACATTTGTGAAGAGAGTCCGCATCGAGCGGATCCTCAAAGCACAGAACGAGGAAGCGTGGATCCTAGG
ACTAAAGAAGTATCTGATGGGGGATGTACGAGACCTGAGTCGGGAAGATGCCAAATCCTACAGCATTATCGCTACGGATTACGCGGTGGATCTGAAAGAC
TTGCTCTTCTATTCCCCCCTACGAAGAGAGTCAACGAGGATCGGGATGGATTGATGAGATTTGTGATGCCGGAAACCTTACAACAGGATGTCCTACACCA
CTATCACGCTAGCTTGGAAGGCGGACATCAGGGTATTGGTCGGACCTACCAACGGATCCGGGAATGTTGTCACTGGAGGGGACTATTC