Description :
From Genome Similarity Track
Location :
Scaffold_192:249- 1402
Transcript NameFunction/comments
Aphin_H310_15016predicted protein

Sequence
1153 bases(100 bases per row)
TCTTCTTGGCCTTCTCGACAGTCTTCTCGTCTTCGTCGGCAGCGTGCTGTTGGGCAAACTGCTCAATGCACGAAATCGCAAAGTACGCCATGAACGCCAC
CATAATGAACCCGCCGGCCTGCGAGATGAGAGAGCTGCTGTCGGCCGCGGCGCCTTCCGCCGCGTGGTCGACCTTGGCCTTGTCAGCCACAGCGTGAAAC
TTGTGGCGGCACTCGAGCAGGAACTGGGCGACCTTTTGATCGAGCTCCCACGACTCGGGGGTGATGGCCGCAATGAACTTTTCGATCTCCGTAAGCGTGG
CGTCGGTGAAGATGGTGACGAAGAACATCGCTTGCAAGTTGGCCTTGATCAGCGCCTTCCCGATCAACGTCGCGCTGAAGAACGTCCAGAACGGCATTTG
AAAATGGCCGCAGCAGATCCCGCACAAGTCGAACGCCATGTTCGGCCACGCGCTCATGAGCAGCACGCCAAAGAATCCATGGCGTTGCAAAAACGAGATC
ATCCACTCCTTCATGTGGTTCAGCGCGTTGTACTCGGAAGACGACGTCTGAATGTCCTCAAACTCTTCGTTGCGCTTCCCGGCCACACTCGCCGCGTACG
ACAGCGCGTACGGCGGAATCTCGCCCAACGCGGTCCCTGCACCCCACAGCATCGACGCGACTGCGACCTTGGTGAACATCGAGACGAATGTCACGTCCGC
GCCGGTCGACGACCCGCAGTTCGTCTCGAATGAACGGAACCACGTGTGGTGGCGCGTGTCGAAGTCGGTCGACTTGCAAAATTCAGCGCCTTGCACGACC
AGAAAGATGTGCGGGAACAGGAACAGAATGCCAGAGTGCATGCCGGTGCCGAGGCCAACGCTAGACAGCACGCCGAGGCCTACCCACCACACAACGTACT
CGACATTCGTGTTGAACTCGTCCAAGTACACGTGGTGTTCGCCCGGTGTGTTGGAGAGGCCGATCCACAGCAACACGAGCGGCAGCGCCAGGAACAGTGT
CAGGGGGTGCGTTGCAAGCGCCACGATCGCCCATCGAACGAAATCCTTGAGCACGATGGAAAAGTGGTACAGCACCGACAGCGGGCGTCGAAATAACGTC
AGTTTCTGTCGCTCGGCACGCAGCGTCTTCTCGAGCTCCGCCACACTGTCGTC