Description :
From Genome Similarity Track
Location :
Scaffold_82:248967- 251649
Transcript NameFunction/comments
Physo_140162reverse transcriptase

Sequence
2682 bases(100 bases per row)
CTTTCTCTGACGCAAAGCTACGGCAGCCCCGCTGCACTAGGTAGCACTTGTAGTCAATCCGACACCTGCGTCTGTATAGACTGACCGTCTGTGGAGAATG
GAGCAGTTCGCTCACTTGCCCCCGAACCAGCAGGATGCGCTTAAAAAGCTTATGTCCTTGCTGCGCCCGGAGGGTGTGACGCAACTTGCGCAGCAAGGCC
CCGACGCGGTGAACATGCGTCTCGAGGCGTTTTCAAGCTACGAGAAGGCTCTGCTAGAGCACCTCCAGCAGAGGATGGCGACGGCCGCGGCGCCCCAAGC
GCCCGCTTCGTCATCCGACGCGGGAACAAGACCCAAGCCGCTCATGTTGAGCGTGAAGACCTTCGAAGGCAAGGAGGGTGAAAGCTTGATGCTTTGGACC
CGAGAGGATGAGATGGCTATGAGCTCAGCTCTACTCCGGACGGAGTCGCAGCGTGTGGCACTAGCTATCTCGAAGCTCGGTGGGCGAGCGAGAGAGTGGG
CACTTACGTCTGGGACGTCGGTCGAGGTGGCCTTCCCGACGTGGGACCAGCTGAAACAGCAATTGTCCCGAGTGTTTGCTCCGCCTAACGAGGCTATCGC
GTGCGCTCACGCTTCCTGGCGACCAGGCAGAGCAAGAAGGAGTTGATGGACTATGTCCAAGAGTTGAGAACTCTCATTGCTGGCATGTCTGCGGACCCCC
TGCCGGAAGCAGTCACCGTTACGGTGTTCATGGAGGGCCTCCGCACTGGCGTTGCCAGGACGGAGGTGTTCCGAACCCACCCGAGCTCTTTTGAAGAGGC
TGTGAGCGTCGCATTGAATACGGAACACACCTTTAAGTCGTCGAGACTTGGGTGGAATGCATCTTACGCTAGCGCGTCGAGTGGTCCGGAACCCATGAAC
CTCAGCTATGCTGAAGACGAAGAAGCCAAGCTTCGTGCTGCTGAGCAGCGTCGCGGTATCCGCAGATGCTTCATCTGTGGTGACATCCGTCACCTTCGTG
CTGGGTGTCCGCTGCGCCATCAGCGCCAGACTTCGTCAAGCCGCTCTTCGAGCTCGAGCCAGGGCTCTGGTTTGTCTCGGGGAACCGAGAAGTCCCCGAG
ACAAACCAGAAGAACTAGGTTCTATTGAGCCTTGGCGAGGTGGAGGTCGACAGGACTTAGCCCCGAAGAGAGTCGTACTCTCTAACACGGAACGTGTATG
CAAGCCAGGCTTGCTAGTTGTCCAAGCTTGGGTGAAGGGCTTCACGAAGCCATGGACGATTTTGATCGATTCGGGAGTGTCGGGAAACTACGCCCGGCGT
TCTACGATGGACGGAAGTCAGCTTTATGCTGAGGCGCTGGTAGCGCGCGGGAGTGATATCGTCACTGTTCGTCTCGCGACGGGCACTCGTGTCACGGTGC
CTAAGGTCCCTGTGGACTTGGGCGTGAAGTTTTTGGATTTTGATAGCGTGGAACGCTGTCTGGTCTTAGACCTCGATTCGAGATATGATCTCATCCTTGG
TATGGCGTGGCTAGAGGGCCACGAGCCTTGGATCGATTGGAGGTCGAAGACCCCTGGTGCTACGCACTTCTCTCCTGGCGGAGCATTGGCGAGTCATGAA
CCCACCTCTGCTAGGAAGTAGTAGCGCTTCTGGCGTGAGCACTGGATCGAGTCGGTCAATGTGCTGGACATCGGAGTCTCCGAGTTGGTGGACACTGAGT
GTGTCGAGAACGAGCGTTCCGAGCGTTCCGAGCGTGGCTCGCGGACGGCAGATGGAGCGGCACTAATTCCGCTGTGCGGGCGTGCGTCTGAGGGCGACGC
CCTGCTGCGTGCCAGAGACGGCGCGGTCGGCACGATGCCGAAGAACAAGGGGCTTTGCCCGGATGAAGATCGTGGAGTGGCACGTCATCCACTGAGTGGA
GGCTGCGGATTGTGCAGCACTTCGCTGAGTGTCGGTAAAGACACTGGAGCTCCCCTAGAGCTGAACGAGGTGGTGACACCTGGCGTCGCGAATTCACGGA
GCTCTTCAGGGCGGACGGTCTCCATGATGAGGAGGCAGCGCCGCAAAGCGCTGGCTGCGAGACGCAAGGCGTCTGTGATCTCACGAGTCGAGAAGGGCGT
GTCGGGCGGTGAGGCTCCACGCGAGAGCGAGCAGCTCTATACACTCGTGAATGGAGTGACGGGCGACGTCGACGGAGGTATCAACCTCGACGACTTGCCC
TCACTGTCTGCTCTACTGGAGCTGGACGAGTTGTCCTTGGCCGAGTTCGGCGAAGCCTTGAATGCTGGAGACTTGGCTGAGGTAGTGGTCATACGACCCG
AAGAAGAGCTGAACTCATCCTCGCTTCTGGATGAAGCTGTCCTGAAAGTGACCAAGAAGGCGCTGAATGCGCGGAGCGGATCGGCGATCCTGAAGGACCC
GTCGGATCCCTTGTATCAAGTGGTAACGGATTACCAGGACGTGGTCTCGAAGGAGCCGCCCTCGGGGCTACCTCCGGATCGAGGTGTTCGACACGAAATC
GATCTCGTTCCGGGAACGAAGTACTGCGTGACGAGGCAGTGGCCCTTGCCGAAGCAGCAGTGTGACGTCATTGACGCGTTCTTCCGTGCGAAGCATGAGG
CGGGTATGGTGCGTGAGAGTAAGTCTCCACACTCTACGCCGACGTTCCGTGTCAGAAAGCCGAGTGGCAAGTGGCGTATCGT