Description :
From Genome Similarity Track
Location :
Scaffold_6:24894- 30033
Transcript NameFunction/comments
Phypl_g263hypothetical protein PHYSODRAFT_470774
Phypl_g26460S ribosomal protein L6, putative

Sequence
5139 bases(100 bases per row)
agctgttTTCATCAGTACTGATTAGCAAGTGCTCAATCGAACGAAATAGGCAATTTCCCCGCCACTGGTTGACCAGCTACTGccgccaagatgctgcgcg
tgTCCAACCTGCTCCGAGGCTTAACTGCTGCGCCGTTGGGTCGTCGCACCGTCCTCAACCGCTCGGCAGTGCGCGCATTCGGTGttcaaggcggcggcga
cgaggacgacgacgaggaggagctaCAGGAATTGgactgggacgacgacgacgacgacgacaacgactgggcgctggacgacgaaggcgacgtgGCCACT
GCCGGCCGGCGTAAGGTGGAGGAGCGCGTCAAGCAGAAGGTGCGAGTGCGGCGCGCGCAGCACTCGAAGCGCCGCTTCGTGGACCGCATCCGCGTCAAGG
CCAccggcggccacggcggcaacggatgcgccagcttcttctccgagtCAGCCATGCGCAAACGTCCCAATGGTGGAcacggaggcggaggcggagacgT
GGTGATCGAGGCCAGTGACAAGATGCAGAACCTGGCAAACGCCACGCACCATTTCAAGGGAGGATCGGGCACCAACGGCATGGGTACGTACTTTGCTGCA
AGGGCATTGGATGGTTGCAATGTTTTTAGCTGGCGCTGACTGGTGCTTTGTTGTTGATGCGGCTGCAGCGAATGACGCTGCCGGTAGGAGGGGCAAGCAC
TGCCACGTGAAGGTACCCTGCGGCACACTCGTCAAGCGTGtggagcgcttcgagcgcgagctggagaacggcGAGTGGGAGATTGTCGACAAGATGGAAG
TCGTGTTCGATCTAGACAAGCCTGGCGCTACTTTCCTGGCTGCTAAGGGTGGCAAGCCTGGACTGGGCAACCGTATTCTGGCGGGCAAGACGACCAACTT
TGGGCGGCTACGGAAGCACATGCCTGAGAACAAGACTACGGGTTCCCCTGGCACCTCGCAGTAttacgagctggagctcaagacgatTGCCGATGTGGGT
CTTGTGGGATACCCCAACGCTGGCAAGTCTACTTTGCTGAGTGTGCTGAGCCGCGCTACGCCTGAGATCGCACCGTACCCGTTTACGACGCTTCACCCGT
ACGTGGGCATTGTCGAGTTCCCAGACACGTTTCGACTGAGTGTAGCTGACATTCCCGGTCTGATCGACGGTGCACACCGCAATGTTGGCCTCGGTCACGA
CTTCTTGCGCCACATTGAGCGCACAAAGGTACGTAAAGAGTGTGCTGTACAAACGCTGTATAAACTCGCCAACCAAAGCGTTTGTCGCTTGTGATGTAGA
TTTTGATGTACGTGCTTGATACGGCTGGCTCGGAGGGACGTGATCCCCTGGAGGACTTTACGCACCTTCAGAGAGAGTTGGAGCTGTACGCCCCGGGCAT
CTCGTCGCGCCCTTCCCTCATCGTTGCTAACAAGATGGATGAGCAAGGTAAGGCTCCTGTCCCGCCAAATCTATGCTGTGGCGTTACCATCCTTGGATGT
GCTTACACTATGCGTGCTGTAACAGGCGCTGAAGACAACTTTCACAAGCTGCGTCAGTCCACTGGTCTTGCCGTGCTTCCCGTCAGGTAAAGCTGCCAGT
ACTGTGCAAACCTTGCTGTCTTTGCAAAACCCACTAACTACAATGTGTCTCCTTTTCAATAGTGCACTCCACAAGATCGACATTGATACGGTGGCCCGCA
CACTCCGCTGGATGATTGAAAGCTACAGCAAGCTTACCAAGTCATCATAGAACGAGTATTTTTGCCGCATTGGCCATATGCTCAGCAACACGAGGGTTGC
CCTTTTCTagtcgtcatcatcatcatcttTTGTGGCATGGTTATTAATAAGGAGCGGGTATGTTTTCGGGCCAAGCTGCGGACGTCTTATTTTCTGCATC
ATTGCGACCGAGGGCTTCTTGCAAACGTGGTGCAAGCACAAGATGAATCGCTATGAGATGCTCGACCGAGTCGGCGATGGGGCGTTCGGCGAAGTTTCAC
GTGCTCGCAGTctcaagacgcaggagaTTGTCGCTgtgaagaagatcaaggcgCTGTTTCCCACGTGGGAAGAGTGTCTTCAGCTGCGCGAACTCAGGTC
GTTGCGGGTACTACGTCACGAAAACATTGTGCTGCTGAAAGAAGTCATTCGAGACAAAGAGGAGCTCTACTTCGTGTTCGAGTACCTGCAGACGTCGCTT
TTTCAGGTTATGCGAAACTTCAAATGCCAtggaggaggcagcagctcaactgGGCTTGGAGGCGAtgcgagctcaagctcagaCCCATCCACTTCACCGT
GGACCTCAACACCTCCGCATCCATGGTTCTCGGAGGCTCAGGTGCGCTCAATTATGTACCAGCTCTTCGGTGGTCTGGCATACATGCACAAACACGGCTA
CTTTCACCGCGACATCAAGCCTGAAAACCTGTTGTGTCACGATGATACACTCAAGATTGCAGACCTGGGCCAAGCTCGCGAGATCCGATCACGACCTCCG
TTCACGGACTACGTTTCGACGCGGTGGTACCGAGCACCAGAACTGTTGCTTCGCTCAACGACATACAACAGCCCCATCGACATGTGGGCCTGCGGATGTA
tcttggtggagctgctgatcTGTACTCCACTGTTTCCTGGAACGTCGGAGGCTGATCAGTTCTATCGCATCTGCAAGGTTCTTGGCACTCCTACCAAGGA
AACGTGGCCCGAGGGTGCAGCAATGGCCTCTCACATGCCAGTCCGGTTCCCCAAGTGTGCTCCTGTGCCATGGGGGCGATTTTTGCCTCCAGGCACTCCA
TCCTCGActgtccagctcgtgcaaGACCTGTTGCAGTACGATCCGAGTCGACGAATTACAGCGGCGCaggcacttcaacatcgctTTTTCGATCGGGCCG
TGACGCGACCGGTACTGACGGGAATGCCAATCCCTCCGTTGGTGATgcctgaagaaggagcgccCGTATTGCCATTCCGGGGTGAGTACAAGTTGGTAGG
GTGTGCTGCTGACACTTCGGGGAACTGGGCTGGGGGAGGTGGGTTGTCATCGCGACAAGAGCACCATTTGTGGACTGCCAAAGAGAGGCACCAAACGCAT
GCGCGGCATCAGGAATGGGGCTCTTCACTTGTCAGTGCTCGTCGAGGCGGGTATGATGAGATAACTGACGCGAAAGCTGTGGCGTCAATCCAAAGCGGTG
GAGGTTCATTCAATGGCAGGTTGATCAAGAAGAGTTCCAGCTACAACACGCTCGGGAATGAGGGCGATAGTTTCTACTCTACCAGGAAATGTACAGCGGA
ggccggcgacgacgacgacgctcaAGACGTCAAAAGCGACAACACGTTGCTACAAGACTTACTAAACGAGATTCTAGGCTAACAGACCTCACAAGCAAAC
AAACAGCTCGATGTTTTGTGATAATTTCATCAGGTATATTGTTCTTCTCATCTTAATCCGTCGCACATCATGCTGCTACACAGGATAGCAAGAGCGCACT
TAGAACTTGAGGGCGTGGGCGCGGTCGCTCTTGGTCAGCGAGAACTTGGCGTTCAGGTAGGCCTTGAGGAAcggctcggcgtcgagcttcttgatcaGAG
CCGAGTCAACGGCCTTCTggtccttcttgcgctgctccgagATGACCGGGGCCTAAGAAGAAGTAACAGCAACACGGTCAGTGTCTTGTAGGGAGCTTAA
GTGCCGAAGCAAGCGATCCCAAGCGCTCATGTGGTGTGGCTAGGGAGCAGCAGAGTCCGAAGACATCACAGCTCCCCGCCTGATCTGCCACGCAAGAAGC
GGCTCAACAACAGCAGAACGAGAGAGATCCCTAAGGGTTCGTCGATCTCATCCTCCTGTCGCGTCACCACTCCATTGCTGGATGTGGACAGACCGTTTGT
AGTGTTCTCGAAGAACCGACCAGCCGGAACGGGATGCTCACAAGGGATAGCAACAGTAAAAAGGATAGGCAAACAAACTTACGGCGCTCGACTGGGCGAA
GAACTGAtcctccttgctcttcttggaagccttctccttggcgaagtaggcgtcgtcgatggcagGGAGCTCGAGGCCCTCAATGTTGACCTTGGTCGAC
GTGGCGATCACGTACGCCTGGTTCACGCGACGGATGGGGACGCCGTTGACCTTGTACGGACCTGCAATTACAGATCACAAATCAATCTGTCAGCAATTTT
TCTtcaaacagcagcaacttgtccCCTATCGAAGACCTAGAGACGGCATTCCTCAGGTCTCATAATCTGATGGATCTTCGGCAAAAAGTCACCCCTCCCC
GTCTGCACAGAACCTCCATTGGGGACCCGCATGCCCCGGACCGACCCCATCCATAGCCCACCTCTAGAAGAGGGGACACGGGACGTAGCCAGCCACGAGA
CACGAGACCATGTAGGCAAGTGCCGACGTACGAGGGGACGGCAGAGCGCCTCTCGAAGTGTCATGTTTGCATCATTGGAATGCCTGCTCCAGTCTCTCGA
TAAGAGCAAAAGAAAAGAACGGAAACTGCGGCTTACCAGTGATGAGCAGCAGGCCCGAAGCCAGCTGGttgaggaagacgacgcgcTTGCCACGGAAGCG
GCCCGAGAGCAGGATGAGCACCGTGCCGGGGGTGATcgacttgcgcagcttggcggtcttgacgctgttgcgcttggtcttggccgacggcagcggcttc
ggGATGTAGTCGGCCGGGTACCACTTCTTGGTGGACGACTTCTTGGCAgcgaccttcttctcgccgccCTTCTTGATCATCTTGCCACGGCCGTTCGTCT
TCGAGAGGCTGTTGCGCGagatggcgttgatgccacgggcgaggacgacgttCGCAGTCTTGGAAGCGGGCATGGTGATGAATATACCTGGTGGGGTAGT
CGTTGTAGTACGGAAAGGTTAGAGATCCAAGCTACAGTCGACAACAAGGCTGCAcgcagagcagcacgacattGGCAGCTTACCTGTCTGAAAAGAACTG
AGCGACCTGTACGGCGGACGAGAGGCCCGGGAGCCAACCACAGCcaaccaggagctggtgtggcgcacactAATGAGGCCTGTACGACGTACTCGTTAGC
GGTTCATCGGTTCGAGTTGACCGGTCCGGGGGTAGGGTT