Description :
From Genome Similarity Track
Location :
Scaffold_6:248929- 250419
Transcript NameFunction/comments
Hyaar_Emoy2801271hypothetical protein
Hyaar_Emoy2801272hypothetical protein

Sequence
1490 bases(100 bases per row)
CGCCATGTCGTTCAACACAGTTTGCTCCGCCATTCGTCTTCTTGGTATTGGCAACTCGACTGTCGTAGGCTCGTCTTGGAGACCAACTTATGGGTCGCTG
GGAATGGATGCAGCTCTGCTGTTTCCGCAACAGTAATACAGACGGTTTCTTGGCACTCTACGTCTGCGCTCATCGCTGTAGATGCTACCATTATATAAGC
TCTGCTGCTGCTACGCTTGGTTGCTCGGCTTCGTCAATGGCTCCGGTGCGTGGTGCAGGGGTGGCATAGGGTGACAGTACGGCCGACATCCGCTAAGACG
GCGACACTTCAACTCAGGTTCGACGATACATATTCGTATAAACACAACTATCGTGTCAATATTAATCAGATCATTAAGTTCTTAATCGCAATGTGAAATT
AATAACGACTATCTCACGTATGTTGTCGAGTGGTTTCTTGTCAGCAACGATACGGTAACAAGTTGTGATTCGACACTACCCAACAATCTCAACATCTCGA
AGCACCCTCTGTATTAATCAACAAACTAATGAACATACTGTAGCAGCATGCCAACATTCTAAGCTACGTCAACATGATGCGTATACTGACACTTTACCCC
CGGATGCACATTACGTGCCAACAAAATGATCGTATTCGTCTGACGTATCTAATGGCCAGTAAGCATTTGCTCCCGCAATTCTACCAAAACTTCGACCAGA
GTCTGACGTTCAGGTTTGACGACACCGTCATACACCTCAGCCCACTCACCTCTAGTCAGCCTCGTACCTTTAGTCTACCTCGTCTTATCTGTAGTCAACC
TCTTACCTATCGGTCAACGCCTGCAAGCGCTCGAGTAGTATTTTATGCTTTTCCGGGGCGATCCAAGCGTTTTTGGCTTGCACCGTCTTCAAAAACGCGC
CCAGTGAAATTAGCTCTTCAATGCTGAACCGTGTTTCGTCAACTAGCTCCGCAACGAGCTTCAAGATATTGCCTGGTTGGGGACCCAAGTAACGAGGCGC
CAAGGTTGTCGAGAGATCGCGAAGAATCGCTTTAACATTGCCCACGATTGTGTCATCATACTGATTGAGGTAGGCTAAGTAAGCGCGGTACTTGACAGGG
TTGTGCATACGCATCTGGATCGCCTTAAAACCACCTTCTCCAATCTGTCTCGAATACTAAAAGACGGTTTGATGTTCGAAGCAATCAATTCATTGAAACG
GATTTCTTGCATCGATTCCGCAAGCTCTTCAGGTCCGGATAAGGCATCAACTCTTGAAAGTAGAATCCATACTCTAGCCCTTGTCGTCCGGATAAGTCTT
GCGCAGTTGTCTCAAAATATTCACAGCAGGTTCAGCACCCACTTTCTCCCAGTACAGCTTGGCGAATCGAGCCACATAATTCTTTCGCCACTCGAAGAGC
CAACGATCTCCAGCACGTCTTCGGGCACCATTCCCGCTCGCAACCACGCTTGTATGAACGCCCCTTTCTTCTTTGCACTGGGCCTTCTCG