Description :
From Genome Similarity Track
Location :
Scaffold_70:24879- 31677
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_70-snap-gene-0.22Chromodomain-helicase-DNA-binding protein

Sequence
6798 bases(100 bases per row)
AAGGATGCCGATAGCGATGGCCGTCGCAAACGCCGCAAGAGTCTCAAGAACATCAAATATGTCGAGGACGATGGCTCCGACGATGAAGAAATCGTTATTG
CGACTGAGAAGAAGCGGAAAGCGCGCCAATTGGACTACCAACTGCGAACGGTGCGTCGATTATAATGACAAAAGGACACATGCTTGTATTATTATTTCCG
AGTCGCTGACATTTTATTCCTCGCCTCGTGCATGAACAGGATTCGACATACCCACAGCTGGATCTGATCGTCGGCCGTCGCATTAACAAGCGCAGTGGGC
TCGTCGAGTACCTCTGTAAGTTCGTCGGCCGCTCGTACCTGCACCTATGGTGGCTCACGTTCAGTGAGCTGGAGCTCTTCATCCCCGAGGGCTACCAGAA
GCAACATCGCGTGCAGCTCTTCGACCGCAAGTTGCGTCGCGAAGGGTACCAAGACATTGATGACGTGGACGACTTAGAGGCGAACAAAGTGACGGTCGAG
AAAATCCTGAGCCATCGTGTCGACCCGCGAGACAAACTCGACGACCAAATCGAAAAGCGCCGACAGGAGCTGCCGTTTGCGCCAAGGTACCCGAGCGTGA
CCGACTACTTCCTGCTCAGCAATGCCGACGTGCTCCCCGAGCGAATGACAGGGATCATTAAGAAGCTTTTGAATGAGAATGGCGGCGAGATTTTCGAGCA
CCCGGTCGACACAGAGTACGTTCTACTTGCTGTACTGTATGCTGGCGGTTTTGAAGTGGTCTCGCTAACGAATTTCATTTTGCTTTATCGGAACAGGGAA
ATTCCAGATTACCTCAACTACATTCTGAACCCGATGGACTTTGGCTCGATCGCGGCGAGACTTTCGAGAGAAAACTACTACGTCGGCCCAGCGGCTGCGT
CGCTATTCATCTCGGATGTGCGGCTCGTGTTCTCGAACTGCAAAGAGTTCAATGCGGCTGGGTCGGACATCTGGTTGATTACTGACGATCTCTCGAAAAC
CTTTGAGAAGTGGATCTACGAGTGGATTTTGGCGCCCTCTGCGTGGCTGAAATTGCAGCCAACCGCTGACAAGGAGATAGACAAGAAACTCACGGAAGAG
TTCCGTGAAGAAGGCGAAGACAGCTACGACCTGTGGTCTCCATGGGAACCTGGGTGCACGATTTGCCGGAAGAACGACAACAGCGAACAGCTTCTTCTCT
GCGATCGCTGTGATGGCGAGATTCACATGTACTGCTCCACGCCAGAGATGACGGAGCTGCCGGTTGGAGAGTGGTTTTGCACGTTCTGCGAGGTGCGCAA
CAAGTTTGAAAAACGAGTGACTGAAGCGAAAGAAACGGTCAAGAAGCAAGAAGAGAATCAACCAAACTCAGACGAGAAAGAGCTGCTGGACGAGAAGAAA
GTCGTGCCCGTGTCGCCGAAAAAAGCTGTGATCTCTGCTTCAAGCTCGATTCCGAGTATCCTGTGTGAGCCAGTGGACGTCGAAGACAAGAAGTTCAACC
GAAAAGCAGTCGAAGCCTCCTCGAAACTCGCGAGTGGTGTCGTGAAAGAGAACGATCGTGCGACATTCTTTCTCGTCAAGTGGATCGGCATATCTGTAAA
GTACTCGACGTGGGAGCGACCGGAAGATATTGGCGACGATGAGCAGATCCAGCGCTATGTTAAGTTCAGCCGCGTGCCAACCCAGAAAGAAATTCTGGAG
AGTACTTGTCAGCTGCCATGCTGCGCGAAGCGAAACCCGTATCTGCTCAACATGACTGCTCAGAAAAGTTGTGACAAGGACCGATTTTGCACGCTCGGCT
GGCGACATGAAGGCGAATGCAGTAGGGAACTCAAAACTCTCGGCAAGGCGTACGGCAGCCAAGAGTACCTGAAGCTGAGGATGGTGGAGCAAGTGAAAGC
GCAGCTTTATGCTTTTCACTGCCTCCTGAACAACCACGCACCTGACAAGGATGTGCTGAAGCAGTGTGGTGTGTTCTCGAACGCGTACGTGAGCAAGAAA
CAACATCTAGTTGGAGCTGCGATTGGGAAGGAAGAAGACGAAGACTACTCCGAGGATGAAAACGCCGATTCATCAGACGAGGAGTACGACGACGATGAAA
TCGCGCCATTCCGTCCAATGTACCCAGGCTTGATCGAAGCCGACTACGGCAACGACAGTGACGACTCGCTGACGAAGAAGAAGGCCGAAGACGAAGTTGC
TGACGCGCTGAGCTCTATCGTTGAGCACATCGTGCTTGGGTACCCGACTGAACTGGAGGCGGTTCCACAAGCAGTGAAGTACAACTCCAAGTTTACCCCC
GCGGCGAGCTTTTCCGGGTTGGCGACGTTCACCGAGTTCTGCGTTGCATTGCGGCGATCGAGTCACGGTCTTGGACTGCGCTTGGGTGTCACGGATGACG
AAAGTGCTTCAGTACTTGGCTTCCAGACCCTCAGCAATGGTCAGATCGGCCCCGCCGAGGCATCTCGTGTGATTTCCGCAGGTGACGTACTCGTTGGGGT
GAATAACATCCCTGTGGGAGGGCTGCCTTTCAAGGACGTGATTCAAGTCATCGGACGGTCGCCTGACTTGATTCTCTTCCACTTCCATTCGCGCCGTCCG
GCGTACTCGTACCCATCGTACTCGGTGGCAAAGCAAGTGGCTCTCCAGCAAGACGTCGTTCCTGAGAATGCGGCGACTATGTCGGAATACATTGACTACA
GCTTCAAGAACTTCCGGCCGATGCTGAAGGTTGGCTCGACTTCTGTATCGTCATCGACCATGTCATCCGTGCTTGATAGCCAGTCGAACTACATCTCGCC
GAATGGACCGATGCAGCACTTGTATGCTGGAGTCATCGACAACAGCATCGATCCGCACGAGCACTTCGCCAGCTTCCTCCCAGCGAAGCGAAAGAAAGGC
AACACTCAAGACAGCAACGCCGAGCGCGAGAAGAACGAGTTTATCCCGTACGAGCAGTCACCGATTTACAAGGGCGGGCGAACTCTGCGTCAGTACCAAG
TGGAGGGGCTGAACTGGATGATCACCTGCTTCAAGGCCCAACGATCGTCCATCTTGGCCGATGAAATGGGTCTCGGCAAAACGGTACGTGACGCATATAC
CTTCCGATGATAAACTTGAGTATGAGTGTTGACTAATTTCTGTTTTGACTGATTTTGGTAACAGGTCCAAGTCGTATCATTCATCGAGCATTTGCGAACC
GAAGAATCCATCCGCGGGCCGTACTTGATCGTCGTTCCACTCTCGACCATCCAGCACTGGCGCCGAGAAATCGAAAGCTGGACTGATCTGAACGTCTGTG
TCTATCACGATGTTGGTGATCGAGCCAACAAATTTACCGCCAAGGACATGCGAAGCATCATCCGAGACCAGGAGTGGTACTACCCAGGAATGGGAAACAC
CATTTTTAAGTTCAACATCCTGCTGACAACATTCGAGACGCTGTTGGCGGACTTTGAAGAAATGGAGCAAATCCACTGGCGATTGATCGTCGTCGATGAA
GCCCATCGTCTCAAGAGCTCCGGGTCTCGCGTGTTGAAGCAAATGCGTGCATTCCGGTGCGACCGCAAGTTGCTTCTGACAGGAACGCCACTTCAGAACA
ACATTCAAGAGCTGTGGGTGCTGCTGAACTACTTGGAGCCAGTGAAATTTGACAACATGGACGAGTTCAACGCCAGTTTCGGGAAACTGATTTCCCAGGA
GCAGGTGGAGGAGCTGCAGAAGCTCCTCGGGCCGTACATTCTCCGTCGAGTGAAAGAAGATGTCGAGAAGAGTATTCCACCGAAGGAGGAGACGATCATT
GCTGTTGAGCTCACAACGCTGCAGAAGCAATACTACCGTGCGATCTACGACAAGAACAAGAGTTTCCTGTACCGAGGAACGAAGAACGCTCTCCCGACAT
TGAACAACATTCAACTCCAGCTTCGCATGTGCTGCAACCACCCGTTCCTGATCAAGGGCGTTGAAGACAGAGAGCTCGAGGAACTTGGCAGTCGGCCTTC
TCCTACCGATGTGATGAACAAGGTGGTGCAGTGCTCAGGTAAAATGGTGCTGGTGTCGAAGCTACTTCCGAAGCTGAAGAGTGAGGGCCACAGAGTCCTG
ATCTTCAGTCAGTTCTTGAAACAGCTGGACATGCTCGAGCGCTACTGCGAGATCAACGGCTTCGGCTATGAACGGCTGGATGGATCGACAAGCGGAAGTT
TACGCCAGAACGCAATTGACCGATTCTCACGCCCAAACTCCAAGTCGACTGTGTTCTTACTGAGTACAAAGGCAGGCGGTGTCGGCATCAATTTGATCGC
CGCAGACACAGTGATCATTTTCGACAGCGACTGGAATCCGCAGAACGACCTACAGGCTCAATCCCGCTGCCACCGAATCGGTCAGAAGAAGACCGTCCAA
ATCTACCGATTAGTGACTCGCAACACGTATGAGAGCGAGATGTTTGACCGCGCGTCCCGTAAACTCGGATTGGAGCACGCGATTCTTGGCACTGCGTCAT
TCAGTGAAACTGCGCAAGTCGAGAAGCCATCGTCAGAGGTTCTCGTGGAGCTTTTGAAGCGCGGTGCGTACGCGCTTATGGAAGAGGATGACACTGCGTC
AAAGGAGTTTGAAGATCGCGACATCGAGACAATCTTGAAAGAGAATGCTCATGTTCGTGTGGTGGACAAGGGCACGGCCGACCAGGACGACAGCGAGGGA
GCTACTGTTCCGAACCATCTTCGCAAGTCACCAGCAAAGAAGCGTGTGCGCAAATCGCTTGGCGGCATGTCGGTGGATCGATCGTCTTTCGTTGCAGAGG
GATCAACGGGCGAGCTTGCAGTGGATGATCCAAATTTCTGGGAGAAGGTGCTACCTGGCGCTGTGTCTGTGGAGATGTTGATCATGAAGCTCGAAGATGG
AAGCGCCATCAGCTCGCGCCAATCCAAGATCAAGTTTATCAGCAACCTGGATATCGCACTGACGGAGTTGGTGAACGAGATAAAGAGCAGCAACGAAGAA
AATTTGCGCTTTGGCGCTAATCTCTCGCACGAGTATGACATCGCGATCCAGATCCTGCACGAGGTGACTTCGAAGTACCGGAAAGAGTTCTCCACCGAAC
AACTGGATCTGGTGAAGAGCTACTTGAACAAACTCGAGAAGTCGCGAGTGAGAAGCTGCCGTGTTCTCCCGTCGAAGAAGGAAATGGATGACGGCACGCC
GAGCAAGAAGCGAAAGCTGAAATCTGCGGCGATGTATGGTTTGGACAGTGACGACGATGTCCCCAGCGCCGCAGAAGATGACGATGATGAAGCTGATCCG
GCCAGAGGATTGTCGAGGAAGGCTGGAAAGAGAGGCAAGCCAACACGAAAAGAGCTGGCTCGTGAGAAGGCTATCTTCAGTCCGAACAAGGGCAAAGCAG
CGAACAACAAGAAGAGGAAAGTAGTGCCAGCGATCTCAGAGCCACTTCCGATTCAGTTCGAAGGCGGAGTTATCAACGACAGTGACGATCTGTGCACGCT
TTGCGGCGACGGCGGCTTGATTCTACTTTGCGACGGCCCGTGCCATCGGTCGTTTCACTTGGAGTGCATTGGCATGGACACTGAGCCGGACGACGATCAT
TGGCTGTGCCCCGACTGCGCTGCTGGTCGCCACATGTGCTTGATCTGCAAACAAGTGGGCGAGATGGGTGCGGACTTTGGCGTTATCCAGTGCTCAATGG
CGAAGTGCGGGCGGTTCTACCACAAGGGGTGCTTAACGAAGCACCCGCGTGTCGAGTGGGTCGGCAAGAAGCGATTTCGATGCCCAAGTCACTTTTGCCA
TGGATGTCCTGCTGATGAACAGAAGAAGCCGACCAAAAAAGCAGTAAATGTCGTGAGCTGCATCCACTGCTCCCAGGCGTACCACCCACACTGTATGAAG
TCCACGGAGCAGTTCATGCGGCTGTCGACCAATCTCATGATCTGCGCCACGCATCTGAGAGAGAAGAAACTGTTGACCCCAGTGAAAAAAGCCGACGCCA
AGAGCTCAGCTTCGATCAGCAACGGGACTGCCACAGCAGTTGCCAATGGGCAAGGTGGCTTAGACAACGAGGAACATGAATCCGCTGCCGAAGTTGACGA
AGACGGTGACGCTGAATCAACTCCTTCTGGCAAGCGCAAGCGCGTGAACCTCCCATCAGTCAAAATCTGCGGATTCTGCCACAAGGGCGACGTTGTCGCA
GATATTGTGATGGTCAAAGCGGACGATGTGCCTCCTTCGAACGGAAAATCCCGCCGGTCGAGCCGATCATCGCAAGCGAAAACCGCGGCAGTCCCTGTTG
CAACTTCGATTGAAGGCACGTTCGTGGAGGCACCTGTGCGCTTGCGGTTCCAGGACAAGGCGGTCGAAATGGTGTATGTTCACCTGAACTGCGCGCTCCA
CTCGCCCGAGGTGTATGTGAAAACGGACGGAGTGTTCTGCAACCTGCCTCGCGCATTAAAGCGAGGACGGCAGCTCAAGTGCTCGAAATGTAAAGAGAGT
GGCGCCACGGTCGGCTGCGTTGTGGGAAAGTGTCGCTGCAATTATCATCTACGGTGCGCGATCGAGAGCGGCGGCGAGTTCATTGGCTCGCCATACTCCC
TGTACTGCAAAGAGCACGCTGCAGCCAAACACACAGAGCCGACAACATACTGCGTCTGCGGATCAGATGACCCGGAAGATAAGACGCTGTCGCTGCACTG
TGCATCTTGCAGCTTGAATTTCCACCCGAAGTGCGTCAACATGTCGGGTCGCCAGGCTGCGAAGAAGTCGAAGGAGAACTGGGTCTGCAACTCGTGCG