Description :
From Genome Similarity Track
Location :
scaffold_8:24876- 37853
Transcript NameFunction/comments
g504.t1 conserved hypothetical protein
g505.t1 hypothetical protein PHYSODRAFT_536864
g506.t1hypothetical protein
g507.t1 conserved hypothetical protein
g508.t1hypothetical protein
g509.t1 conserved hypothetical protein
g510.t1hypothetical protein
g511.t1 hypothetical protein PHYSODRAFT_470654

Sequence
12977 bases(100 bases per row)
GCTAAGGGATCGCGCTGCGACCAACCGGAATCGCGCGCCCTTGAGCGCCAGCGACATGATGAGTGAGATCTTCCAAAAGAGGGCTTCTCGAGGACTGGTT
TGGCTATCTCTTTTTCTCCTTTTCCCCCCACGAAAGATCCACCGGATAGGGCCTCTGCGCGGCTGGCTTCTGCCTGACTGTGTGTATCCTCCTGCAGGCA
GCCAGCCGTCGTGCGGAAAGTTAGAGAAATTTTTGTTAGCGTGAACTCGGTCTTCTCCTTGGTATGTCTATTATTCAATGCAGCAGGCTGGGCTTTATGC
GAACGAAAATACCTTTGTTGTTCCTCTGTGCGTTCCCTATTTCGTGCTCAACATACACCTGCCTTGGTGTATCTGATACATGACGTCATGTTCTCGTCTA
CAGACGACGGTCTACCTGTAGCTGTGCACGCACCCGATCTCGACTCAAGATGATGTCGGTGATGGTGCAACGAGCCGACCGATGAAAAGGTGTTTACCAG
TAGTTGTGAGTCTCCCACGCTTGAATATACCAACCTCGAAAGGAGGTCTCGTTTCAGCGATGAGCTCGCGTTCTTCGTCATCTTCCTCCTCCTCTTCTTG
CTCACGACAGAATAGACCACGACCGGACGGAAACCCATGAATCCACTTACCGATATACTTCCTTCCGTCCGGAGAAGACCACGACCCATAGCCCTGGATG
TCGCCCTTGAACCAGTCACCTTCATACACTTCTCCGGAGGCGAAGGTGAGTGTACCGATACCATGCCGCTCGCCTGCTTTATACTCCCCAGTGTAGACAC
TCCCGCACTGGAAGCGATGCACGCCTTGGCCATTCAACTCGCCATTTAGCCACGTTCCATGCAGAGATCCACCCGCGGACACAAACACGCCCTTACCATG
CATCCTGCCTAGATGCCAAGTCCCTTCGTGCGAGTCTCCACCAACCCACTCGTACTTGCCAAAGCCTTCGCGCTCGCCTTTCACAAAATAGCCTTCGTAC
TTGTCTCCAGACGGGAAGACCTTCATACCCCACCCGCTGACTTGGTTGTGTCTCCAGCTACCGTCGATCACTTCCCCAGATGAGAAAATCTTCTTGCCTT
TGCCATGCATCACCCCTCTTTTCCACGCACCTAGACGAGTCGCATCGTAAGGGCATCAGCTACTCTGGTGTATGAATCAATGCCTAACAAGTCTTGACAT
TGCTTCTCACCATCGTAGCTGTCACCATTCTTCCAAAAGAACGTGCCGATGCCATGCATCTGCGCGTAATACAATGCAAAGAATTATACTTAGTCCATAA
CTCTCGTACAACAATAATAACCTCTCAAATAAAAGCATACCTTGCCAACACGCCAATTTCCCACGTACTTGTCACCATTGGCCCACAAGTACGTCCCCGT
TCCATGGCGGCAGTTCTTTCGGTACATACCTTCGTGGCAGTCTCCTGTCCCAGCAAAGGTCTGCATGCCAAATCTAGCCCCAAGTCCAGCAACACCATTA
CTAAATTCATTCTCAAGCCAATCTGACTATGGTTCCGCACCCTTCGAAGTCTCCATGCACCCATCCTCCCTCGAAAATATGCCCAGATCTCAATAAATGG
ACACCAGTGCCATGGCGTCTCTCTTCCTCGTCTACGCCTCCTTCATAGCGACTTCCGTCCGCGTACTGGATCACGACGGCTCCTCGTGGCTTTTTCCAGC
GGATCGACAGAATCTCCAGCTGGTTGTGCTCGTCAGGACTGGAATTCTCGTCCGACTCGGACTGTGGCGTCGACTCCTGCTTCTTCGTGCGCTCAGCGGC
CGTCGGATCTGCTGGGTACGCAGTGCGCGCTCCCCGACGCCGCCCGCGATTGCCCATTGCGCAGACTTTTTTACTTTTGGGGTTGAAAACTTGAATTGCT
TGATTTTTGACCAATAGAACGGAACGAAAGAAACGGAAGGCGAACTTCCAGCAACGTAAGATGCTCGCAGAGCTTCGTGTATTCCTCGCGCTCGTGTGGT
GGCACATTTGCCACTTCCTGGCCTACCACCTGCACGTGCGCGGTCTCAAACCCACTAGCCAATTCCTCCACAAGGTGGTGATCATTGGGGATGACTTTGC
AGCGGGTATTGGAGACTACATCACCATCGGCAGCTCTGGCGGAGGCATCGCCGCGTATCTTCAGAAGATTGTGACGTTCGAGGACAAGGCAAGTGATGCA
CTAGCTACAGAGACAGCATAGTTTATCGTGTATAGCTTTACATCGGTCCAGCTTAACAATATACTTTCTGTCCTTTACCGCAGGTTCGTCACAACTGGGC
CATCATCAACGCAGGAGTGCCTGGATCTACAACGGCGGACTGGCTCATGACGTCGCCCAAGAAGGTGCGTGGCTGGTCCTTACTGGTGCTGTTCCTAGCT
GAGAATTTGTGATACGTCTTGCCGGTGGGTTAGTACTTCAAGAACGTGTTCACGTCGAGAGCCATGGGCGACGCGTCTATCGTGATCATCATCCTCGGAT
CCACGGAGATCAGGTGCATGCAGCAGGAAGGAGCTACTTGATGGCTCTTGCATCAACTAACGTCTTACTGATAGAAAATCGGGCGCAGGTGAGCACGAGA
TGAGGCGGAACCTCATGGAGATCTGTGATACGTTGCGGAAGAAGGGCAAGCAGGTGTGTTTGGCCACAGTTGCGAGCCCTGACCCAACTGCCACCGAACC
AGACAGTGCCAGCTTGACTCTCAACACGGCGCTGGAACAGTTTTGCAAGAGGTGGGTGGCGTCTGGATCCAAGGAGCAACTCAAGTAGTCAACTAACACA
CTGCCTTGTTGTGTGCGTTGGGCAGCACGTCGACGGAAGAGGCACCCGTTATTCTCGGACCACGCCTCGACACGTACGCTTTCCGCCGCGAAAGTGCTCT
CTGTTTCGACAAGTACCATTTCAACTCCCAGGTACGGCAGGTGATCGGAAACGCCGGTTGTTGAGGCAAGATTTGGCTAACCACACGTGTGTTTGTCGTC
ATGGCTTGCTTCTCCGCACCTTGCAGTCGTACCGACAGCTAGCTCGTAACACGGCGGATTTCTTGGTCCCCATGATGACCGCTGTGGAATGGACCACCTG
GAAAGAACAGCTCAGCAACGTCACTTACGACAAGGCCTTGTACGACTAGAGCAAGCCACGCGCACTAGCTTTCGCCTGCAGTATCGACCGCACTTCTTCC
GCGGCGACTCGCTGGCTGGCTGCTTGCTTGCGTCCGTCCTCCATCCAGATAAGATAAACATTAACACCCTCAGGAAACACGCGAGCTTTCTTTTTCTTTC
GATTTCGGTATTGAGTTGCCACCTTCGCCCTCTCTCTCGCGAAGTCAAGTGATCTGTTCACTCACACGTGGCCTTCACAAAATGTTCATTTGCCTTTCGC
TTCCATGCCATTGATCTACATGTCCACGTCTGCCACGGTTAATGACAACAACTCGTCATCTTCTCAAGACTCCATAGCGGCATCAGCGCCCGACTCCGCC
TCCGCATTGGTGTCAGTTGCGGCGTTGTCTTGTGACGGCTTGGCAGCCCAATACTCCTCCATCTGACGGTCCAGCTGAGCCGCCTTCGGATCGGGGCCCT
TGCCGGCTTCGTGCCAGTACTCGTCCATCTCCATGTCGAGATCTTCTCCAGTGGCAGGCTTGGCCTTCGCGTCTCCACGGCCGCGTCCGCCACGACCTCC
TCGGCCTCCTCGGCCTCCACGTCCGGCGCCCCTGCCTCCTTTCTGCTGGTTAGGGGCGTTCTTGTTCTTGTTCTTGTTCTTGATCTGGTTACTCTTGGGC
TTGGCTTCCTGCGGCGTGAGCCCCTTCCTGTGCTTGGTGACAACCTGCTGGCGCTTGTTGCGGTTGTTCTGCGCGACCTGCTGCAGCTTCTGCTTCTGCT
GTTGCTGCTGGATCTGCTTCTTGGTGGGGGCAGGCGCCTTGCCCTTCTTCTTGCCGCCGGCAACACGCAGAACGGGCTGGATCTTGCCCTTCTTCTGAGA
GACCTTGACAACCGTCACCTGGTGCTGCGGCTTCTTCTGCGCTGGACGCGCCACCGTCTCATCCGCCAGGTGCGTGAAGCGGCTGGACAACGGGACGGCC
GACACGCCGATCACGCCGCGCGCCGTCTTCTTGCCCTGCGGCTGCTTGCTGTTGATCTTGCGCACAGACGCGCGAGGAGCTCCAGATCGCCGATACATTC
TGTGGACACTTGGCTTTTGAGAGAATGATCGAAAAAAATTCTCAAAAAAAACGTTTCTTAAGTTGCGTTAAGGAAAATATTTAAGTTGTTCTAAGGAAAT
GGATTAAGTTGCTCTATGAATTTTCAAAAACCGACCGAACGGGCAAAATGGCCGTGGCCATGGAGGCGGCTCTAGTGAGCCAGGTGCAGCGCTACCTGGA
CGCTTATGTGTACGAGAACGCGCGGTTTCTAGCAGAGCGACTCGTCGCGCATGTATGTGTAGCTTTTCGGTGGATTTTGGAGCTGTAGAAGCTGAGCTAC
AGCTGTTTGAACCAAAGTATCATTGCGCTTTTGACACTTTTCATGGTTTCTGATAGCACCCGAGTGAAGAGAACATGTTACTACTGGCCACGTGCTACTA
CCGGAACGGACAAGCAGCTAGAGCAGCGGAGGTGCTAAGCGGTGCAACCCGGCCCGAGAACCGCTACCTCTTGGCGTGCTGCAGCTTTCAACAAGGACAG
TTGGTTGAGGCGGAGAATGCGCTGCTGGGCGGAGAGAACTGCCATATTGACGACTTGGAGGCAATAGAGAACGTGCCAGCGGGAGCTGCTGGATTGTATC
TGCTTGGTCGAGTCTACAGACGTGGAAATCGGAGGCAGCAAGCTGAGGTTTGCTTTGTGAAAAGGTACTGCGAAAATGGAGCTTGCCTCTGGTTGAGGAT
GGGAGTTTTGACCTTGTGGCTTGTACTTTGGTGTTGCTACTAGTTTGGAGATCGACCCGTTCATGTGGTCGGCGTATGAGCAACTTTGTGAGCTTGGAGC
TAACCTCGAAGCCTCCAGTTTCTTTGGTGCAGCGAACTACTTTAACAGCACTGGATCAGCTGATACGAAGGACTTTGGCTCCAGCCCAGAGTTTGGTGGA
CAACAGTTTGCAGATTATGATGAGTCTAACAATCTGGAAGGTCGATCTACGGACGGGGCCTTGGCGACACCGGAACAACCAGCGGGTTTCGGCCTCGATA
CGCCGAAGAGCGTATTAACGTCAGGGTTGCGAAGCTCAAGACCGCTGGCATACAAAACCCCGAACGTGAATACGAACAACGCAAGCAACATCCACACTGC
GACTGTTGTGAAGAAACCGCGGGTAGAGGACATTGGAGCTCCTGCGCGACAGCGGAAAGCTCACCGAAGGCCTCTTACAGATACCGACGACAAGCACCGA
CCTAATGCAAGACTGTCGTTCTCTGCTGCTGGATTTGACAATTCACCACTGGTATGTTAAGAAGCTCACTGTTTGTGCCCTGGTTTTGACTTACTAACTT
GCTATCCTGTGTTGTAGAACCCATCGAGATTGTCGCTAGGCTCTCCGACGTCCCCGCTGCTGACGAGGCGTTTTTTTCAGGACAAGACGCCAGTCCATAC
AGAAGCGCCTTCACATCACGTTGATAGTCGGCATGAAGTCCTCCGTTTGCTTAGTTCATTTGGCTCTATTTATCAAAAAATCAGTGGGTACAAGTGTCGA
GAGGCTTTGGAGATGCTGGAGCGGCTTCCTGACTCGCAACGTGCATCCGGTTGGGCGCAGCAACAGATCGGGCGAGCACATTTCGAAATGGCCGACTACG
TGCGCGCTCAAGAAGTTTTCTGCGCCTTGCACAGAGCGGAACCCCATCGAATGGAAGGGCTCGACCTGTACTCAACGACATTGTGGCATCTGAAGAAAGA
GGTGGAGCTTTCGTATCTCGCGCAGCAAGCTACAGAATTCGATAAGCTTTCGTGCGAGGCTTGGTGTGTTGCCGGCAACTGTTTCAGCCTGCAGAAAGAA
CATGACACAGCGCTGGCCTTCTTCCAGCGGGTAAGTTAAACCTGTAAACTGTGTTGAAAAATGCTTCTGAATAACGCTTCTTTGTTAAATCTGCAGGCCA
TCCAACTGGACCCGTCGTTCACATACGCGTACACCCTCTCCGGTCACGAGTACGTTGCAAATGAAGATTTTGAGAAGGCGGTGAACTGCTACCGACACGC
CATTCGAACGGATTCACGGCACTACAACGCTTGGTATGGACTGGGAACGATCTACTACCGGCAGGAGAAGTTCGAGTTCGCTGAGTATCACTTCAAGCGC
GCTCTGGAGATCAATCCTCGGAGTTCCCTGTTGCACTGCTTCCTGGGGATGGTTTTACACGCCACCCACCGATACGACGAAGCTCTGGACACTCTTGCCG
TCGCCGCCGAGCTGCAGCCGTTGAACCCTCAAGCCCGTTTCCAGCGTGCGAACGTGTTGATCACTCTGCAGCGATACGATGAGGCTCTGGACGAGCTGAA
AGTCGTCAAGAACTTTGCGCCGCGTGAATCTTCCGTGCATTTCCTGATGGGCAAAGTGGCCAAGAAGCTCGGGCGGATCGAGGAGGCGATGAAGCATTTC
ACCTTAGCACTGCACTTCCACCCCAAGGACAACAACCAGATCAAGATCGCCATCGACAAGATCAACGAACCCGATCACGACGACGACGACCGCATGTAGC
AGCAAACTCCCCCCATATAACATAAATATGAGCTGAGACCATCCATCATTGACCGTTTTTGTATGGGCATTTCTCTTCGTTCGACTATGACGCCGGATAT
GAAAGCCGACGCGCGGCTACTGCTGCACCAGCTCACACAGTTCCAGGACGCCAGTGAGGCGCTCACCCGCTTGTTCGACGGGTTAAATGCCGCCGTGTTG
CTGCAGTTGCTGCATTGGCAAAACACGCCAGCGTCCAGAGGTCTCGTGAACGTACTGGAAGACCTGGAAGCCAGCGGTAACGATGTCCAGCCAACGGTGC
GCAGTGACATGGAGCTGACAGTGCTGGGGAAGCCTGCACTGCTGTTCGCCACGTCCATCTACGACGAGGAGCTGGCCATGTTGATCTGGTCGGGCTTTCT
TCAATTCCACAAGCTGTATCCGACGTTCGACCTGACGCGGCAGGTGCTGGACAACTCCGCGGACTCACTTGGATACTCTGCTCTGCACTATGCAGTGGAG
GCCCAGATGGGCGAGTTCCTACGTGCAGTATGCAAGGAGCTCGAGAGCGACAAGACGGCGCCAGTGGCTGCTCGAGTGGTGACTCAAGACGTGACGTTGC
CAGTGAACACGGCGCAGAACATGGGCAAGAACATCGCTAGTGGAGGCTGTTCCCTACTGCATCTTGCAGCCAAGAAGGGCGAATTGGACATGGTGAAGCT
GTTCGTGGTGTCCCCAATGCTACTGGAGCCTCAAACTCTGCGGGATTGGGACGGCAACTCACCAGCTCGAGTGGCAGCCATTCATGGTCACCATCAAGTC
GCTGCGTTCTTGGAGGTAAAGCTAGAACTTTATGGTTGATGGTTTGATGATCTAACGAGTAAGTTCCTAGGGTATCACTGGTGACGTGTCATTAAGCGCT
TCGGAAGTTGAGGAACTACGAGCCAAACGCGAAAAAATGGCGAGAGAGCGCTACCTCGCGCACTTGAAACCTCATGAATCCATGCTGGAGCCGTCCGTGT
TTCAAGGTATCTGGACACTAGAGGAGACGACGCTCGTTCGGAACGAAGTGAACCGATTAGCTGCTGAGCAAGGCTGGTGCAAGGAGCGTCACGCTTCGTA
CCAGACAACGGACATGCCCTGTCACCAGGTCGCTGCTTTGAACTCGTGGGTACGTTCGACTTTAGCTGCCAGACTCTTCCCTGAAATCGCAAAGCGGTAC
AATCTGCCCAAGACGAAGCGACTGCTGTTCCGGGACCTCTTCTTCGTCAAGTACGAGGCGCGGAAGGGCGAACGCTCGGAGCTGGCACTTCATCGAGATG
GATCCGTTTTGTCCTTTAATGTGCTGCTGAACTCGGCTGAAGAGTTTACTGGGGGCGGCACCTACTTTGACGCCACGAAGCGTACTGTCCACATTGCAGA
AGGTGACGCTGCAGTTCATAGTGGAAAAGTTCTTCACGCTGGAGCGCCGGTGCTGTCAGGTATTCGGCAGATTCTTGTGGGCTTCCTGGACGTCGCGGAC
TGCGTGTATTGAGATCACAAGCGATGGAACTGGATGCCCTCGATGGGTGTGTCCCCCTCCAGCACATATAGTCGTGGACACCAGTGCTTTTCGTCGTAGA
TTTCGTCATCGAGAGACGTCTGGATAGAAAGTGTTGCCTTTGCCTGAGTAAAGGTGTTAGTTGGCACAATGAGCCAAACTTGATAGACTGCAACTTTTGG
CATCCGTACCCGCTCAAGCTCGAAAAAGAGGATGCGATCTTCCCAAACCTTGTCGTACGTGTTCCCCATCATCTACAGTAATACGACAACGACAGCGTTA
GTTGGCTCACTATTTAAACTGCAAACAAGTGTGAGATCGTACGGCAATCAGGAGATTTAGTAACATGATGGTACCAATAACCACAAAGGCCAGAAAGAGA
AGAATGGCAAGTAAACCGCCTTCGTAGATACTGTCCCAATCCCACGAGCCTAAGCTGATGTTGAACGTCGTTGTGACAGCTGAAAAGTAGTTCTTGCATC
CTTCAAGCTGCAAGGCGAACGCAATGTCAAATTGATAGTGCCAATATTTTATCACAGTGTTTCACGTACCTGTAAAATGAAAAAGGCAAATGCAAAACCG
AACAGGAATACGCAAAACACCATGACGAAGACCAGAATATCCGAGAACATCTACAAAACAACAGTAAGAGTGAGTACGGCGTATACTAAAGCTTCTGAAT
GTGCACACACCTTTGCAATCATGCGAACAAAGGGCCCAAGGGCACGTGTTCCTCGAGCGAACTGAATCCACTTGACGAAGATCTGCGGCCCCACGATGCT
CATTAAAGTGATGCGGAAATTGTATCTCCTGCGGATGTTGAAGCTGTACAGCGATTCTTGATACACAATGAGTCTGAAGTCGTTCTGGTCAAAGTCTAAC
CAAGAGTTGTCAAAACCAGTATTCCCCTGCAAATTATCAGTTCACGCACATGTACCTGGGGATACCATTTCGAGAACTTCTGCGACCAGCAACAGCCACA
CACACGAGATCTGAACTAGGTCGAACCAGTTCCAACCATCTCGGAGATACAGGCGCAGACTCCCGCAGTCTCTATACGCTTGGTACTGTAAAAAACACAC
ACACAAAGTTGGCAAGAGATTGCTTGCAGTATAAAGTACCTACGATACCTCTTGGAGAGTGTACATGGCGTTGATAACGGAGTAAATGAGGCGCGCGACG
TCGCGAACGTATTCCATGGCTCCGACGTCCTCGTTGAAAATATTATTGCGATATCCTCCAAGCGGCATGCCAACAAATGTGTCGCCAATGTGCAAGTACC
TACACAGAAGGCGAGTGTCCATATTTTAACTTTCAGGTAGCGGTACAAATAATACTTTAAGTACTACGTACGTGGCCACAAACACTGCAACAAAGTACAC
GAAGTACACCTTAAACTCATAACGAAATGTCTGTTTAGTGAAGGAGTTCCATCTAAAAGCGAAAAAAAAAATTAGCGTCAATACAAAAATTCCCCGTAAG
AGAACGTACTTGTGGTCTAACAGTTGCCGAAACCACGGGTGGAAAATGAGATCTTTGCATTCGGTCTGTTATCATACAGTGATCGTGTTAGTATAGAAAG
CAAAACAGAACAATCCAAGCAGATCCACGTACCTGGATAATCAGCCACAGAGTTGGGCTGTGCCGACTTCGAAACTCCGCGTGGTCGTACACGTACTCGT
ACAAAATTCCTTTTGGCTCGCAAACAATTGTATCCTTCTGCCTGTCTTCGTCTTCCGTAACTGTAAATACGTGTTGGACGCTCAGCACGTTTCTCACGCG
ACGTAGGAACTTCCAGACTTTCTTCAAAAGTTTCAGAAGGCGAGAAACAGCCCTTGCGAGTGATCCCTGCTTGCGCCTTCGTCGTGGCGAACGCCCACCT
TTGCCTTTCATCTGCACTGTCAACGCATCTCTCTTCTCGCGGTACGTTTTCAGTTGGTTGCTCACAGTCCAACGTTGGTTGCGCTCGCGAACGTGCTTTT
GCATACTACATCGGAACAGTGGGTTGCGAAAGGAATCCATCGCCAAGACGGCAGCTTCAGGGACATTCTGGATCAACAGGTGAAACAGTTTGCTCCTCTC
ATGGAGCTCTCGTACTTTATTGAGCTCGGAAGGAGCCACGTGCTCTGAGACGACAAGAACCCCAAGCGTTTTCGGGGGTAGAATTGAATACCCCGGCGCC
GACCGGAAGAATACAATGTCGCGGCGATTTCGAGTGCACAGAAACGGAGAAGCCAATAACGTATCAACTGTTGAGCACGCACTGTCATTCGTCGTCCCGA
CAGCATCGTGTCGAACATTCGCTCGTCCTGGAACAATTTCAGGTGATACCGCAGCAGTACCTCCTGCTAGTGTTTGATACTGCGGTAGATGGGTCTTGCT
GTCCGGTGGACGCTTTTGCTGCACCATAGCCCCCGAGCGAAAGTTCAGGGACGGCAGCAACTTGGCCATTGCCTTACCGTCGGGAGAGTCCACAAATGTC
CCTCGCAGGACTGTACCGTTCAGTGTCGAGAAAGTTACGTACCGAGAAATCCTCACATCCGCGTGGTTTTCCACAAAATGAAGACAAACTCCGTGACGTT
GGCTTGCTATAGCAAAATGAAGTCTGCAGAATAGTGACAAGTTGGTAAGTGATTTGCCAGTACGACAGCCACAGCACCACGTACGGAGTTTCTCCTGACT
TGTTCTGGGCGTTGATATTTGCTCCATTTGCCAGCAGGAGCTTGGACAGCGTGAGATGCCCGCCTTCCGCAGCGTAATGAAGTGGCGTGTTACCTGCCGC
GTCTCTCGAAAGAACGAGCGGATGACCACAGATTTGAAGAAGATCCTGCAGCGTTATCGCTTCATCATGTAGCTTGTCGAGGGAATCCGAGAATCGAGCG
AACGAGACACCGACGTCTGCTATAAGAGCTCGCATTTCAGCGTCCGACTCGCTTACAAGTCTCTTAGTCTTGCGCATTTCCAGAACGAGCTCCAGTAGAT
GACTCAGCTGCATGAAGCTGTACTTTTGATACGGAGAATTCATCGGGTACTCATTCCAATGCATGATCAGCTCGTTAACCAGGTCCGTGTATCCACGTTG
CGCTGCAGCGTGCATGACCGTGTATCTGAATAGAAGAAAACCATTAGCATTAGCTTACTCGGAGAATATCATCAAACGTACTGGTCTAAACCGTGTGGCT
GTAGGAGATCCAGACCGTCATTCGCTTCGTTCTGCAAGATCCGAAGTATTTTAGGCAGATTGGGCTCTGCAAGTCGGAGAACACCGCTCTCCGTTGTCAT
TGGACCGGGTACAAGAGGTCTGCACTTGCAGCATTCGTCGAAGAGCAGCTTGCTCTGCAGAGCGAGGTGCTGCTCGTCTCGGTTCTCGAGTAGTAGGTGC
ATCCGGTAGTATCTCCGCATTGCACGGTTGATCTTCGCTGCCGCCCAACCCTCCGGGCGTTCGCTGGCATTGCGGAATAGGAACCTTTTCAAGTAGTTTC
CTCCCTGCAAGAGGCGAGTTGGACTCTCCTTCTTCCTCTGTGGGTTACGGTGGGGATGGACATGCTGCGCTCGAAGTGGCTCCTGTCGTAGGTGGAGGCG
TGGAGGCCGCCTCCGAACGTCTTCCAGGATCACTTGCTTGTGTTGCTTCTTCTTGGTCGCTCTGGTCTCCTACTGTAAGAGGTTAGTACAGCACCCAGAT
GCACAGTATACACATTGTACTGTACCTTTATATGCGCTCGGTACGCCTCTAGAACTTCATCACGCGTGGTTGGAGCGCCTGGGGGCACCATGGGCGCAGC
ATAGCGCCTCGCTGTATCTGGCACCATCTATATGCCCGTTCACGTTGAAGTGGTTTTATAAGTTATAACAGTTACAAACAAAGCATATTGTATACACTTA
ATTTTTGTGTTCGGTATACACCCGCAAATATGATATCAATAATTGCACATCTTTTGTGCCATTATTGTCATAGCAGTTGCTGCGTCCATGGAGACCATGG
ACGGCGCCTTCTTCTCGTTCCCGTACGAGCCGTACTCGATCCAGCTGGACCTGATGCGGCAGATCTGGGAAACACTGGAGCAAGGGCATTGCGGCATCTT
CGAGAGTCCGACAGGCACGGGCAAGTCCATCAGTCTCATCTGCGGGACGCTTACATGGCTGGCACACCACACTGACGAGTTCGGACTGCTGCAAGGCGCT
GCAAAGGCTGACACAACGTCCACAGTAGCTCCTGATACCAAAAAGAGTGCGGAACCGAGCTGGTTGGACGACTTCGAGCAGAAGACGGCAGATCGAGAAG
TCAAGTTCCGCCAGCAAGTGGTGAAGGAGGCGCTGGCTGGCATCGAGAAGCTCCGACTGGAGCCTGAAGCTTCCACGAAGAAACGGAAAATGGGGATCGC
CTATAACCACAACGGACGGAAGCGGTTGCACCAAACAGGAAGAAGAGAGGGCAAGCAGGATGAAGAGGAAGGAGAGGAACATTTGGTGGATCCGTACGAC
AGTGATCGAGTGGCTCGTCGCAATAGCGAGAGTGACGACGAGAGTGGAGAGAAGTCAAAAGGACGCTTTGGCGAGGAAAAGTCGGACTTTGGCGTCGTGA
AGATCATTTACTGCAGTCGAACGCACTCGCAGATCTCGCAGTTTGTCCGAGAGATACGCAAAACTGTGTTTGCGGAGCGTATCCGAGTTGTATCTCTGGG
TTCTCGCAAGAATCTGTGCGTCAACCCGAAGGTTACGAAGCTCAACTCGGATTTAAGAATGACCGACAAGTGTCTGG