Description :
From Genome Similarity Track
Location :
Scaffold_283:24868- 26266
Transcript NameFunction/comments
Phymu_g8046conserved hypothetical protein

Sequence
1398 bases(100 bases per row)
AAAGCATCCTTGTCGCTAGCGTTGaacttcttgttcttgttcgtcttcttcttagGGGAAGAGGTCTTGGCAGGCTCGGCGGCCTcaacagcagccgcag
cgggcttctcgtccttggcaCGCGACGTCTGCTCGTTGAACCAGACCTTCTTTTCCTTCACGGCAGCCAGCGACCCCGAGACAGCAGTCGCAGAGGTGGG
AGGCAGCAGGCCAATGGTGCTGAAAGCTTCCATCTGAGCAAGCGGCAGGACCAGCTTCGTgggcttcttcgccttcttgccctGACGGCCCTTCTTTCCC
TTCTTACCGCCGCCAAGCATCATGaagtcctcctccttgcgcTGCAGGGGCTTCATGCCGTCAAGCTCAACCGGAGCGGCAGCAGtctcggccttctcgt
cctgcacCTCCTTAAGTTCCTTGGCGTAGGTCTTCTCAAGGAAGGTAACGAGAGCATCGCAGAGGTCCATCTCATCCTGGTACGGGTGGATCTTGGCCAT
CTCCTTTTCGTAGTCAGCAAGCTTAGCCTCATACTCAGCCTTGCgggcctcctcctccttctggcgctcgagctccttcttcttgcggacAAGACGGATG
TTGTTGTAGTACTTGTCGTTGGCCTCCTTAAACTCCTTACGCAGAGCCTTAAGCGCCGtgaacttctcgtccagctgctccttgatctccttgcgctcct
tAGCGAGCACAGGGaacttgtccttcttgttTTCCTCCTCGTTGAGACGGTAGAGCTCGTCAagttccttcttctgctcgttgagcttctcctgaaCAGC
GTCAatctcctcgttcttcttggcctgcagGGCACGCGTCTCCTTAATgctctcgttctgcttctccacgacTCCCTGGTCGCCCGAGAAGGCAgagatc
tgctgcttctgagcctgcagctgctcgatTTCCTTgatcacgcgcttctcctcgttcaaCGACATGGAGCTGGTCTCCTGCTTGTGCTTAAGCTCAGAAA
TAGCAGCATCGTACTCGCCTTCCGAGTTAAACTTGAGGTTAGCACGGGCGCTACGCTGGGACTTGACGGTCGAGTCCTTCTCGTCGCGGGTCTGGCGCAG
ACGGGCCGTGATCtggttgcgctgctggatgaggttctccttctcgttgcgcAGGGTCGCgaacttggccttggcctCCTGGATCGGGCCGCCGAAGCCG
CCGCGGCTCGTCTTCAGTGCGTCCATCTCGGCGCGAATCACGTTCGTGcgcgcctgcagcttcttgatggcggcgtccagcacgttgatcttggcgtcGT
GCTCGGCCTTGTCGGGCTTGGGGAGACGCTCGATCACGTCCGGGAtctccatgtcctccacgacggcagcaacaacgggCTCCTCGCTGCTCATGTTT