Description :
From Genome Similarity Track
Location :
Scaffold_432:24862- 26343
Transcript NameFunction/comments
g3939.t1POM69185.1 Ubiquitin-protein ligase sel1 [Phytophthora palmivora var. palmivora

Sequence
1481 bases(100 bases per row)
AGCTTGAACTGCAGTAGCACCATGACAATGCGTAAGGACGGCTCCTTTTCACCCGCAAGGTGATAGTAAAGCGTAGCTCGCTCTGGCGAAATGAACGACA
CCCCGAGACCATGCTCGTGCATGTACCCCACACTGAAAAGCGCTCGCGCGCTTGTGCCAGCACTCACCAGGTCTGCATGTTGATAGTGCCTTAGCGCAAC
AGTATAGTCTTCATCTTGGTAAGCACTGTCACCCATACGCAACAGCGCGTCAATGCTGTCTTGCTCAAAGGCACGATTCACAAGTCGAGCATATAAGCGT
TCAAGCAGCTTTGAGTCACGGATAGAGGGAGTGCCAAATACTTGTCGCTGAACACGTTCAATCAGCCAGACAGCATTGTTCTGCGCGACTTCATAACCCA
TTTCAGCAGCAATCAAGTACAGCTCCAGCGCTAGCGCCCAGTTGCCTCGTTGCGCGTGGGTCAGCGCTTGTGTCATCAATGTTGTTCCTTCTCGTGAGTA
TTCGGCCACGCGCTTATAGAGCTCAACAACTTCTTGACACGATGTACTGCTCGTGGTTGCACCTCCAATGGTGTGAATCTGCCGCTGCTTGAGTCGAGCA
AGCTGGAAAAGCGACTTGAGATGGCCAACGTGTGCCGCCGCAACGAGATACTCTTTTGCCCGTGACGAAAGGTGAGACCCGAGCTCCAAGAAAGACATGC
CCGTATTGTAGACACCTTCGGCATGACCTGCGTTAGCTGCAACTTTGAAAAGGTTGCGAGCTCTGTCAGGATCGACAGGCATGTCACCAATGCCGCGCGA
GAAAATAACACCGAGGCCATTTGCTGCTTCACCGCTAGGATTTCCTTCCGATGCGTTCAATGCAGCTTCGTAGAGCTCTACAGCTCGTGAGGCGTTGGAT
TTGCACCCTGCAAGTCCGTAGGCGTACACGTGACCGAGAAGAGCCTGAGCCTTGATGCTGCCCATTTCAATTGAGCGCTCCAGAAATCGTAGTGCCTCAC
GTTCACGAGCAGCGTGTTCTTCAAGATCAGACATAGCTGTAACACCGTACAGGTCGCTGAACAAGGTGATGCTAGCCGACTGAACCATCACGTCGGTGTT
GCGGAGGTCAGCAGCACGCTGTCTAAGATACTCAGCTCTGTTGAAGTCTTCTGCCGGGTTGAGATCGCCATGATATCGGGCACCCTCGGTCTCGGAAAGC
CTTGCAGGTTCAGGAAAGGCATACAGCTGAAGCTTCTGGTCATTCTGCTGGGTAACGACTCGATCCGCGGCGAACTTGTAGTGCCTCATAGCTGCCGTAC
AGGACTTCCTTGAGCCGTAGCCGTGTAAGGCGCGATAACCAAGCGCCATGGAAGCACCGATCGATTGTCCACGAGTAGCAAACGCGTAGTATAATTGAGC
ACCTGCACTGTCATCAGAGGCAGCTCGCAGAGCACCTAGGAGGAACTGTGCTTGGGAACTGCCGTGCCCAGCACTAGCTTG