Description :
From Genome Similarity Track
Location :
Scaffold_360:24862- 26237
Transcript NameFunction/comments
Pytap_DAOMBR444fgenesh_masked-pag1_scaffold_360-abinit-gene-0.38Rraga protein

Sequence
1375 bases(100 bases per row)
GTCCAGCCTAGCTCGTTTGCTGGACATAGCTCTCAAAAACTGGACGCGCAGCCTTGATGTTGAGGTGGATAGTAGCAGGCTCTGCAAAGTGAACAACACG
GTGTGAGCAGAGCACGTACTCGTCCAGATACGGTCTGAGTTGGCACTTACGGATCTTTTGGtCAGACATGATGACCATGATGTATGTGTTCGTCGTGAAG
AAATCGATGAAGGCGGTAAAGTTGGAGTTGCGCACCTCCATGCCTTGGAACTGTGCCTGCGTCTTGCTGCaGCTAAGCTTGAACTGCTTGATGATGTTAC
TGATTTTCTCGAATCGATGGATGTCTCGGTGGGTCGCATGAGTGGCGTGGGAGATGACCaGGAAAGTTGCGCGTTCGAAGAGGACGACCTCGTCGGCATT
GCAGACCGCACAGAAATCGTTCAGATGAGTCTCCAGATCTTGGATGTTTGGAATTAGTGAGTACACAATCGACGACCACGCGCGATACAGAGTCTCATCC
CAGATCGAAGTGCCGAAACAAACAGTCGGAAGGGAGCCGACGCGCGACAAAATCATCTCCTTCTTTTGCTCAAAAACCTATACCAGCGAGCCGTCAGTAC
TTTCCCATACTTTTCCCCTTGGTGTATCCACCCGCTTACTCGGTCACGTTGGTCTTCAGGCACAAGATCCATCTTGTGAATCAACACGAACACCTTGGCG
TTGCTCGAGTTCTGGTCAATAGCTTCGAGGCAGCCGTCAAAATGGGCCAGATCTTTCTGCATAGGAGCATACGCTTGTCATTCCCATGCAGTCACACTCC
TAATAGCGATTGGAACATACGTCGATCTCACGGCTCTCAATGTCGAAGACATAGATGAGAAGCTCGACACTTCGGAAGATGTGGTCGCGCTGACTCTCGA
AGTAGTTCTCGTAGAAGGCATCCTGGCTACATGATGAGGACACGTCACCTTTCTGCTCACACAAGCGCCGACTATCACAGTCCACAGCACATACCCGCCG
CAGTCCCACAGGTTGAGCACAAGGTTGCCCAAGAAACGCACATGCGAGTGCTCCACATCCACTGCACACAGAGGCAATCATCATTAGGCCCCGAATCAAC
CTGCATTTCTCACATCTCACGTCACGTACGAGTCGGTCCCAAACGCATCGTGTCGCGCGCTGTGAAGATCCCACAACATCATTAGATCGATCTGGTCGAC
TGAATCCTCACGTGCTCTGTACGTACCCAGGTAGTTGGCGAAAATGATGGAGCGCATCGAGGTCTTGCCCGACCcGGACTTGCCCATGAGCAACACCTAC
ACGCACACGGAACCACTCAGTACGCGTCCTGAGGGCGTGAAGAGCCCCTCGCCGCGCACCTTCTTCTTCATCTTG