Description :
From Genome Similarity Track
Location :
contig_105:24851- 28198
Transcript NameFunction/comments
g11084.t1hypothetical protein

Sequence
3347 bases(100 bases per row)
GCAGTGACCGAGCTGCCATTCCCTGCTTCAAAAAAGGGATGCAGTCTTTCCTCGGTGCGCTGAATTATTACAGTCGATTCATCCAGGACTTCGCAGTGTA
TGGAGCAGCTTTGTACCAGTTGAAGGACGAAGACTTCACGCCTAGTGGCAGCCTCTCGGCGGCCAAACGAAGCTTCGCGGCGCTCCAACAGAAGGTTGCA
GAGGCACCGATCCTCCGGCACTTTGACCGAGACAAGGAGGTGCATGTCACGTTATTCGCGAATGAGTGGGCATTGAGCTCCACTTTGATGCAATACCATG
ATGACAAGCTGCACCCGGTTCGATTTTGTGGCCGAGTCCTCAAGGACGCCGAGATGAACTACCACCCGGCCGAGAAGGAGGTCTTAGCGCTACTGCTGGT
GTTGAAAGTGTGCTACTCCCAGTTGGTGGGTCGGACCATCCACGTCTATACGCGTTTTTCGACGCTCGAATGGGTGCACAAATCCAAGACACTGTTCGGT
CGAGCGACCCACTTTGCGGTTATGTTGTCCCCGTGGCACCTGGTGGTCAACCGAGTCAAGGAACGCGATTGCACGTTTGCTCAGCTTCTCCAAGCTGGCC
TCACAAGCTTCGTGGATTGGAAGACTCGTTGGCCCAGTTACACCGCCGACGAAAGGGTCACCTACTGCTCGTATGGACCCCCACTTGCTTTATGCCTGCC
TACCGAGGTCCTATACCGGATTTGTGATGTCGTTCGATGGTTCGGCCAAGACCGAAAAGAACGGTGGATATGGCAGTTGCTCGTGGATTTTGTGGAAATT
ACCAGAATGGACTGTAGTGACGGCTGCGAGTGCTTATCTCGAGACCACCACGGTAAACCTCGCTGAGTATGCTGGAATGAACAACGGCGTCTCAGCTGCG
CTCGAACATGGAGCCGAGGATTTAGTCATCGTGGGAGACTCGAGACTCGCAATCCAGCAGTCCCTAGGGGTGATGGCATGTCGAAAGGAGTCTCTGATGG
TTCAACTGAATCGTCACCGAGAACTCACGACCAAGCTGCGGTCGGTGAAGTACTTGCACGTGGTCCGAGAATTCAACGCTGCAGCAGATTCGTTGGCAAG
CGAGGCTCTCAGCAGCAAAGAATCCAGCGTAGCTTCGACCGAGGCTAGGAAATTAGAATTGGTCGAGCTGAACCGGATCGGAGAGGTCATCTATGAACCC
TCAGTACAGACCACGGCCGAAGAGAAACCGACAGTCAGCTTCGCCCGAGCCCAAGTAGCCCGTGGAATCTCCCGCGACAGATCTTTTTTCGACTTTGTGC
GGGACGAACCCGACTACCTAACTGCAACAACCAGACACCAAGCAAAAGCGAGGAAGAAACGAGTCCAGTTTGCAGATGAAACGTCGGTGATAGAGCCGAA
TGGTACGGCTGAGCGAGACGAAGCGAATGGTGTGACCACCGAAGCTCAGAGCTGAGAGCCGAGCAATCGAGCAACGAGGTAGACCCTGGCGCTCCAAACG
CAGAAGACGTTGACCCTGTGGTTATACAGGAAGAGCGCCGGAGACGAATCTCCGCCGCCCAGGATGAAGAGCTGAGATGGTCGAACCTAAAAGCGGTCCT
CCGAGGCAAGGAAACAGACCTCAGCTACAGAGCAGCCAGAGACGCTTGGAAGATGGCCGACAAGTTCGTGCTTAGCGAGGATGGTGTACTGTATTTTCTT
GGAACGAACCGTCGGTGGGGCAACGAACGCCGAGAGGAGACAACGATGCGTCTAGTGGTGCCCACAACGATGATTCAGGAAGTACTACGGAGTTGCCACG
ACTCGTTGGAAGGTGGCCACCAAGGTATCGGTCGAACGTACCACCGAGTCAAATCAGACTATTTTTGGATTGGACTATATGCAGACGCCGAACGACACGT
CAAGTCCTGCCCCGACTGTAGTTCGAGCAAAAGTCGACCACAGTTCCGAGGCTATTCGCCAGGAAATGTCTTAGCAGAGCGACCGTTCCAGATGGTGTCG
ATGGATTTCGTCATACCGTTACCGAAGTCTCGTCGGGCAACTCAGCCCTACTACTGTTCCAGTGCGCGTTCACAGGATTCGTCATGGGTAAAGCTATGTC
AGACACTACCGCTCTGAGGGTCGCACAGGCTTTCGAGGAATGCGTGTACCGAAGATTCGGAGCACCAACTCTGATCCGACATGACCGAGACCCTCGCTTC
ATGAGCGAGGTGTTCCAGGCCTTTGCAGAAATGATGCAGTCTCGGTCAAGAGCGACCCTGAGCTATCGGCCGCAGGCGAACGGACAGCAAGAGAGGTCGG
TGAAGACGGTCATGCAATCGGTGCGGGTGTACGCAGAAGACCCGCTGCAGCAAGACTGGGACGAGATCGCGGAGCGATTGATCTTCGCTATCAACAACTC
TGGCACCCGGAAGGACACTCCGTTTTACCTAGTTCATGGGTGGGACGCACAATCCACGCTGCGAGCGATGTCGTCGTCACTCAAACGAGGATTCGGAGGC
CAGACTGACGCATTGGCATGGCGCCGAGAAGTGAACCGGCAACAGGAAATCTCGTGGAAAATGGCAATGGAGTACCAAAGTGTCGAGAAAGCTCGGAGGG
CGAGAGAACACAATGAGTCGCTGGAGCGACGTGAGAGAGCTGCAGTACCGAATGTCGATGAAAACGAGACTTCTGACGAGTCACAGGTGGAGACGGGGGC
AACATCTGACCCCACTGTCGAAGGACCGAGGTCTCTGTTCCAACCCGGAAGCAGAGTTTGGTTGTATATGGAACGAGTCAAGCCAGGGTTGACCAAGAAA
CTCGCCCACCGATGGCATGGACCATTCAGGATCAAGAAAAAGATCGAAGAGTTTGCGTACGAGTTGGAATTGCCAGACCGAAGTGGGTATAGGTTCTACC
CGGTGGTACACGTGTCCCGACTCAAGGCCGTCGAATTTGGAGACCGACCGAAGAGTCGGTTAGCACCTGAAGTGACCGAGGATACGAGACTGGACTTCGA
CGAGGAGTTGTTGCCTGAAGATAGCTGGGAGCCAGACCAGCTCGCTGGCGAATATGAGGTAGAAGCCATCCTCGATGACCGATCCCCGCTGTCGACGGCA
CTAGCCGCGCTGTCCGAGAGTTCAAGTGAAGTGGATTGGGTATGATGAGCCCACGTGGGAGCCTGCCTCAAATTTATCATGTGGCGGGCTACTTTATGAT
TATCTGCGGACTCGGCGCAGCGAACGACGATTGCAGATGGTTCAAGTGCTGACGAGAACTAATCTGGAGAGCTACCGAGAGTTGAACTGTCTACGGGGGT
GATACAGCCCGTAGCAACAGATGAAATTTGCTACTGTATCAAAATTG