Description :
From Genome Similarity Track
Location :
Scaffold_155:2485- 3720
Transcript NameFunction/comments
Physo_143861hypothetical protein

Sequence
1235 bases(100 bases per row)
TAGCCCGACGGGATCGCGTAGGCCGGAGGGCTGAAGCCGATGAACATCATGAAGATCGAGTTGAAGAGGATGCCGGTGATCTGAGCGACCTCCTCCGACG
GCATGGCGTACGCGAAGAACTGGCCCAAGTACACGAACATCAGCACCAGCAGAGCGGACTCGAGCCAAAACACCACAGCCGTCCAGAACCCCGTGAAGCC
CACGAACCAGTAGAAAACGACGGTGAACAGCAGCGAGCTGACGAAGCAGTACGGGATCTCCGCCAGCGTCGAGGCCATGAAGTACCAGAACGCATTGAAA
GTCTGACTTGCGCGCTCACGGTAAAAAGACTGGCGCTCGGCGCACGTGAGAGGCATCACGCTCTGGAACACGGCCATCGAGCTGAAGAACGAAGACATGA
AGACCATGCCGACGCCCGAGTTCAGGCCCGAGTACGACGCGTAGTCGTCGTTGCCGACGAAGATCAGGCCGAAGAGCAACGCCAAGAAGATGGCCAGGTA
CATGCGCGTGAGGTTGTAGCTCGGTGTTCGCCAGTACATCTGGAAGAACCGCCACACGACGAACTTCATCTGCGTCATGGAGCTGGCCGCACGCTTCTTG
CCGAAGACGATCTCCGGGAGGTCTGGGGACGGGGTAGTGATGCCTTCCTTCGCCATCGTCGTCTCCAGTTGCTGGTTGTACGGACTGTTCTTGAAGTAGC
TCACGAAGTCCATCGAGTCCTTGGATCCGTGGCCCACACCGGCGCCAATGCACTCCAGCATCCACGTCGCGGGGTTATATCCGACTGGAAGCGGGGCCAC
GCCGGGGATGTTCTCGAAGTAGTCGATCAAGTTGCGGCAGTCCTCACCCAAGTCACCGTAGAACGCGGTCTGGCCACCGCGCTGCAGCAGCAACAGTCTG
TCGAACAGGTAGAACACCTCAGCCGAGGGCTGGTGAATCGTACAGATGATGGTGCGGCCCGAGTCGGCCACCTTACGGACACCGTCCATGATGATCTTGG
CCGAACGCGCGTCCAGGCCACTCGTCGGCTCGTCCAGGAAAATCACACTCGGCTGAGCAGCAAGCTCCACACCGATCGTCAGTCGCTTCATCTGCTCCAC
GGAGCTGCCGCGGATGATCTGGTCTGCGATGTCTTCAAGTCCGAGCAGTTCGATGCATTCGTCCACGGAGTCGTACTTCTTGGCGTCCGAGATCGATGCA
TCCTGGCGCAGGAAAGAGCTGAAAGTCAAGGCCTC