Description :
From Genome Similarity Track
Location :
Scaffold_117:24845- 26717
Transcript NameFunction/comments
Phyci_240329Hypothetical protein

Sequence
1872 bases(100 bases per row)
ATTCTTCATCGCGATGGTCTCCGCTGTTCCCCCGCTTCTCGCGATTGAGCTGGTGTTCCGGTCTAAACCCGCGTTCGACGGTCTGCCGGACTTCGTCACG
CTCGTGTCGCTCTTCCTCGACACCTCGGTGCACCTCACACTGGCCGAGGCGTGCAAACGTGACTCGATGAGGTTGCTGGGTCGCATCTGGCAGAACTGGC
AGACTTTCGTGGGTGACGATAGCGACGCTCCCTGGTCGATCCACAAGTTCACGCGGACGGACCCGTTCTACCTCCAATTCCAATGGACTTTGGCTCTCAA
GGAGGCCATTCGCCTCGAGAACCTCGACATGATCCAGTGGCTCTTTGCCGAGTTCCAAGGATATACCGTCACGACGGACGTGGTGGCCCAAGCAGTGCGA
CAAGGAGCGATTCCGATCCTCCAGTTCTTTTTGGACAACGGAACGAGCTACTCCGCCCCCGAGTCGGTGAACATTAGCCCGGCAGCGGGTGCTGGCCACC
GCGTGTGCTGGGCTCACAGTTTGGTTGACGCTGCCAAGGCTGGGAACAGCAACACCTTGTGCTGGGTGCATGACAACGTCAAGACGCACACGCGATGATG
GATTCGGTCTTCGAGGAAGCTCTGAAAAACGGCGTCACTCTGCCTCCTGAGTGGGGGTTCCAGCCAAAGCAAGCGTCCTTGCCTTTCGTCAGGCGGCACC
GCCTTGTTCTCTATGCGGTGGAGGAGCGACGGTTTGACATTCTGCAGTGGACGCTGCAGTAGAACATGCTTCCAGATGCGGCGGGTTTGGTGGTGAAAGC
TGCGGAGAATGAACACTTTGATATTGTGCGATGGCTCGTCGAAGGTGAACACCCTAGAACGACCAACGGCGGGGAGAATGGATTCCCTGAAGCTAAGGCT
GAGACTCATTTATTGTTCTCGCTGCTGCTGTCAACGGACACTTGGAAATTGCAACGTACCCCCAAGCGCAGCCCCCAGTATCAGAACGAACTCAGCAGCA
GATAATTGACCTCGCGACAAGGCTTCATGACTGGCTTTACAGCTTGTTGCTACCCGTTCATACGCTACCGACGCGCGTCTCGGCGAAAACAATGAGCGAA
GCAGTCGGACATGGGCATCTCGACGTCGTGAAGTGGCTTTTGAAGCGTACGGTGAATCGACCGAGACCAAATTGTTTGAAGAAGCAGTCGATACGAATGC
AATGTATGCTGCAGCCGAGAACGGGCACTTGGACGTGCTGCAGTACTTCCACGAGCTACAAATGTAGATCGACGCGAGTGCCAAGAAGCGCAAACGGGAT
GAGTTACAGCGGCTGAGACCCCAGtgcgcaatagcagccatggatggcgcggccgcaaatggccacctacacatcgttgaatggctgcatcagaaccgca
atgagggctgcTCACCTCGTGCCATGGATAAAGCTGCATGAGCTGGACATCTTGAAGTGGTCAAGTGGTTGCACGAGAATTGGTCACCAGAAGGGTGCAC
CACCTCTGCTATCGATGACGCGGCACGAAATGGACATCTTTTGGTTGCCCAGTGGCTTCATCAGCACCGATCAgagggctgtacaacgggtgccatcgat
gaagcagcggcaaacggtcatctggagctgcttcagtggctgcacgagaaCACCGGTGCTGGATGCTCGTCTAAAgccatggatctggctgctacaaatg
ggcatcttaacttgatggaatggctgcACACTTATCGGTTGgatggagccacaacggatgcaatgaatggagcagcagggcgtggtttcttgaatgttgt
gatgtggttgcacaagcgccgcagcgaaggttgtacACACCAGGCTACGTATGAAGCGGCCAGGAATGGTTA