Description :
From Genome Similarity Track
Location :
Scaffold_141:24841- 26599
Transcript NameFunction/comments
Phyke_g4969myosin-like protein

Sequence
1758 bases(100 bases per row)
ACTGGCTCCTCACGTGTATTCTGTGGCGGATCAAGCGTTCCGGACCATGTTGGTGCCTCGTTCGGGtaccaagaaggcgaacCAGACCATCCTTGTGAGT
GGTGAGAGTGGTGCCGGTAAGACGGAGACTACGAAGCTCATCATGAACTACTTGGCTTATGTATCGACGAAGCGCACGCACCGCCCGATTCGAGCAAGCA
ATTGTGATCAGACGACTATCCATGACCGTGTCCTCGAGTCGAATCCGATTCTGGAGGCCTTCGGTAATGCCAGGACCACGAGAAACAACAACTCCAGTCG
CTTCGGTAAGTTCATTAAGCTTGGATTCACTATCAAAGGCGAGATGCTGGGTgcttccatctccacatACCTGCTAGAACGCGTTCGCCTTGTTTCGCAG
GGCAAAGGTGAACGTAACTACCACATTTTCTACGAGATGTGTGGCGGTAGCTCACCATCTGAGCGGCAGGAACTGGCACTACGGGCCTTGAATGAGTACG
AGTACTTAAACCAGTCTGAGTGCTATGAGCGTTTGGACGGCGTGGATGACGCAGAATCATATCACTCGACACGACGTGCCATGTCGAGCATTGGCATGAG
CCCAGAGGAGCAACTGAACGTCATGAAGGTGGTCTCAGCTGTGCTGCATTTTGGAAATGTGGATTTCACGACTGCTACTCGCAATGGAGGAAAGGATGAT
GCGTCTACAGTGGACATGGAACGTTGTGGTGAAAGTGTTAACTCCATTTGTGCGCTTCTGGGGGTGGAAGAGGACGTGCTTCGTAGTACACTGTGTACGA
AAAAGATCAAAGCCGGCGCTGAATTCATTACGACTCGTCTACCGGTGGCGCAGGCGCAATCAACACGAGACTCTGTGGTCAAGACGCTGTACTCAAACCT
ATTTAACTGGCTTGTCGACCGTATCAACTGCAGTATCGAGTACAAGGAAGAAAATGGCGGCAGCCAGTTCATTGGTGTGGTTGATATCTTCGGTTTTGAA
ATTTTTAAGCAGAACCGTCTCGAGCAGTTGTGCATCAACTACGCCaatgagaagctgcagcagttgtttGGACGATTTGTTTTCCGAATGGAACAGGACC
AGTACGTGGCCGAGGAAATTCCGTGGAAGTTTGTGGATTACCCAAATAACGACGTGTGCGTGGCGCTCGTGGAAAAACGTCATATGGGTATTTTCTCTCT
CTTGGACGAGCAGTGTTTGATCCCCCGTGGAAACGACGAGAAACTCGCCAACAAGTACTACGAGTTGCTTGCCGACAAGCACGAAAGTTTTTCTGTGTCT
AAACTTCAGCGCGCGAAGGGCCAGTTCGTGATCCACCACTATGCCGGAGATGTCTGCTACATGACCGATGGCTTTTgcgacaagaacaaggacCACATGC
ATACAGAGGCAATTGACCTGCTGCGCACCTCCAAATTCGCGTTTGTTCGTGCATGCTTCGAGAACAGCGTCAATGCTGGTGGTAACGCAAGTCCAAGGAA
CGGTCGTACGGAATCCCGCAGCAGCGATACTATCCGGCGTCGTTCTGGAGGTATCATGTCATCCACAGTCGTGGCGCAGTTCAAGAACCAGCTCAGTTCA
CTACTGGAAGTTCTGAATGCTACGGAGCCGCACTTTATCAGATGTATCAAGCCAAATGACCAGGCGAGCGCTTCTGAGTTCGAGCGGAGGCGTTTACTGG
AGCAGCTGCGCTGCAGTGGTGTGCTGGAGGCTGTCAAGATTTCTCGTAGTGGCTACCC