Description :
From Genome Similarity Track
Location :
Scaffold_174:2484- 7532
Sequence
5048 bases(100 bases per row)
CATTTTGCGCCCTCAATATATCTTCCAAGTATTCCACAACTAGCATCGTCAATTGGTCCGAAAATGCTGGGTCATCTAAGGTCTAGATATAATGCTCCAC
ATGTTCTTTCTGAATCTTGGGCAATCCATTTTATATCATTAACTTCTTCTCGAGTGTAATCACATTTAACAATACATATAGTCAAAGGTGGATTCATCTG
AACTCTTCTTCGCGTGGTAGTACGGGCGAGCAACTGGTACCCCAAGACCACAGAACCGCATCTGATATTTTTGCAGCAGTCTTTCCAAGTTACTCGAACT
GAGCGACTTAGTTGGAGGTATGAGTTCTGTGGCGGAGCGTTCAATATCCTCCAAAAAAGATACACTTTTTTCCGTCTGTTGCTTGGTCCCTCGTGAAGAC
GGTCTTCGAAGTGGCCATCGAACTGCGTACTCGGTCCCCGTCCAGGCATTGTTCATTGAATTTTTTGAGATCCAAACTCGCTGGGTCCTTGATTCGGGGA
CCACGTTGGGCCCCTTTTTCATCGTGGCATTATCTATCCTTGTCGAAGGTTTCCAGATCCAGGTTTTTGGGTCGTATTTGCAAGAGCCAACTTATTCATG
TCAATATCAGATATTGTAGGTTTTCTTGGGGCTTGGCCAACTATACTTGGATCGTTTCAATCGGTCGCCGTTCGAGATCCCTGTCTCTCTCTGGTCTCTC
CCCGGTTGTAAAGTGTTGGTTGCACTTGACTTTCATGAAGGAATCTTACCATTTGCGCGTCGAAGTATGTCTGCAGATTACCGACTGGGTAGGTAGGTGC
TTCCTTTTTCACCATGTAGTGTTGTAAAGGTTCAAGGATGACATGGTCAATCCTTCATTGATTATATTTTCATCATATCAGGAGTCAGAATTACCACTGA
CTGTCCACACGTCACCTTCGTGAGTGAGCTGTTCAGTCAGCGCTTCCCGCGCACGGACCTGAAGCAACGCGGCACCTGCAGGATCCAGTGGCATTCGGCT
GACGCTACTAGGAGCTGATGACCCCTGTGACGAATGCCCCGCTGCGGCCTGGGTATGTAGAGACCGGTTTTTGCGAGGTAGGTCATCCATCGACCATGGG
TCCCAGGTCCCTACATGTTTGGGGGGGGGACCTCGATGTCTGGGAGCGTCAATTTGTATGTAAATGGTTCGTACACGTTAGCCGTGGGAGATAAGCCGCG
CTTTGCGAGGTTACTCCGATAGGGACCCCAAACACTTTTGCAGTATTTTTAACGTTGTATTAATGCTGTCGAACCCCAGGCCAAACAAGTTGTCCATTTC
AGATTTCCTCGCGTCCGGCTCAAATCGCCTCGCGACCATGCTTGATTCACCGAACGATGGTAACTAGCGCCGTAATTGCAGGTGCGATCGTTCGTATCAT
GGGAAGGCACTATATTGGTCCACAAATCTGTCCAAACAGCCTGATCTCAAGGAACTTAATAACAGGGTTTCTCATTAAGAACGTGTCAAGCTTGCGTCGG
TGGTAGGCCATCGTCATGTCATCGGCCGATTAAACCAACGGGCCTGAGCTTTCGGGGTCGACCGACCTAGTGTCGGGGATTGATTACTCAGAGTCTACCG
ACTCGGTGTCCCTGGCGCCCTTATCTTGAACCTTTTCCGCTTGACAGTTGAGGTTTTTTGTTGTCGTTTCAGGGACCTTAGCGGCTAGGTATTCACCGTT
AGCTGGTGTTCCTCTGGGGCATGATAGATATCATGACCCAAGGTTTCATCCACGAGGACATAGGGAGGTAATTTGGGTTTCTCTTCAATACGTTTAACCT
TAACCATGTTGACCAGACCCCTTCCAATGTTCGGTCAGAATTTCGATTCTTTAGGTATTCGTCTTGTATCCGTGCTATCTGGCTTTCAGGGAATCTTCGG
TCTTTTGCTCAATCTCGACTTGAGCATCTTCGTTGCCTTGGGACTAGCGGTGAAATCCCGCGTCTTGTGAGGATCCAGGCACGCACACTATTGTGGTCAA
TTCGGTTCTCAAAACTATATTATGAGCCTCAAAACACTCACTGTGCCGGACAGCTGACTTAGGGGGGGAGGGATACCCCGATTACGCGTATGGGCCTTGA
CTCACCTTGTGTACCCGTCGGCTGGCGGGTTGCACTCTTCGGTAGACTCTGATGGAGACGAAGATGTTTTGGTCTTGAGAGACGTAGACATGGAACATCG
AGTGGATATGCTTCACTCGTTAAGTCCAGTGGGCGGCCACTTGATCAACTTGGTCGAGAGTGAATTCATGCCAAACTCCTCTCTCTTGTTCATTTCCTTG
CTCCCTAACCGCTAGGTAGGGAGACATCTTCCGATAGAGAATATTGAGAGAGGGGCTGCTGATCGATGAATTTACAGGCCAAATATTTCCTGGGGTCTCA
CTCGCACTTGGTCTGGCCACGCAACTGTCTTCAACGGCAGAACAAAGTATATCCCTTCCCCGGAACAGGCGGGCAGACTTATCGGGTTTCTTCTTGAGCA
TGACAAAGACGTGCCATGTAGACCGCAAATTGAGTAGTATTTAATAGCGTCCTATCCTTTATCTCCTTTACTCTGTCATTGCCTTATGATCTGACTCTTT
ATTTGTCTGGTCAGGAGTAGCCGGCTGTGAAGGACCAAGGTCTACCAATGACGGACCGGGGCAACCAATGAGATATTAAGGTCGACCAATGACGGACCAA
GGTCTGTAGATGAGGTATTTTTAATTTTATTATTAAATGGGGCGTTTTCATTTTCCACTCTTTTTATAATAATCGTTATATTTCCACCATACTTTTTTAC
TATTTCAACCCCACCATGACTTTTGTTGGAACAATTACAGGCACACAACCCCTCCCCACTACACCACCATATATCTTCCACCCCTCCCTCAACGACGATC
TCCGATCATTACACCCTCGAATCGCAAAAAAACGCCTGTGACATAAATTATCACTTAAGGGAATCGTCTATAGGAAATTGCCCTGCCCTCTTCTATCTAT
CCCCACAATTTTGCATCAACATCGCCTGTTGTGCAACACTTACTGACTGATCTAAACTCAACCCAAATCTAAAAGATATTCTAATCGACGTCTTCAATAG
AATGGCCATATTTAACAATGCATACACCTCGCTTTGCCTGGTACGCATATTCCTGGTTATCGAATACAAAGTCAGTGATGATCTCCAAAATAAGTATCTG
AATTACCCACTTTTTCTAGACAGCAACCACGTCACCGAGGTATCGTCCACATCAGATAAACTCCCTCTTATTCCATATTCTTGTCTCACCCTCCATACTT
GTACTCGTCATCGCCCGTTTTTTCGGGTGAAGAGCACTGGCCCGTAAGCAATGGTCAGCTGATCTTGTCATCCAAATTTTATTTTGGATACCAAAGCGGT
GGATGGCTTTCTATCGAGCACATTTTGATCGATAATAATGGGGAAATGGTGTGATTTCTGGACTGAAAACTCGAGGACGGCCACCGAAAGCGCAGAAACC
AGCTAGTGACAGGAAAGTACGTGTAGGAAAGTAAACGAATCAGCTGCTCTCCTTCGACTAATTTCCACACTTCGTATCGATGTTAAAAATGGTAAAAGTC
TTCTACTATTTGTATATAAGAGCATGTGGTGGTGTGGTGCGCCTTTAATTATCGAAGAAAAAATTATAGTGTGGAGGAAAAAGTGAAAAATGTGGTGGAA
ATAACAATTCCCTTATTTATTACGGGTGTAAGAGGCCTATTTGAACAAAATAAATCTGGTGACCAGTTGGAAGGCTACCAAACCCCTATTTGTGAGAGTT
TAGAAAAACCGTCTGTAAACCCTTCACAAATGATGCGTGTAAGCCCTCTCAAATCTGTCAGACTTTATACTTTAACAGACGGTACATACACACCTTTATT
TGCCAAGATCACGACACGTGGCACATCCATAGCAACATGAGGAGACTTGAAATACACCAACATTTCGCCTGAATACACTAACATTTTCGGCTTTTTTTTC
GTTGCCCACCTACACTGTGACCGCTATCTATTAGACCTAATTATTGTATTGTCAACAGGAGTTATATGAAGGGCCATGGTTTTTTTTTTCTACCGTTTCT
TCTTAATAACCCCTCACCATTCTCACTGTCATGTTGAGCCCTTTCACCATCCTCTTCTGGAACGATCGCATCCTATGCAGCAATGTGCATGAGACTATGC
GCATTTCTCTCTGATGTACTGAGAGAGATACGGGGCTTCTAGATACCGGCAATATCACGACTAGCCCGTGACCTTGCAAGACCGTAACACTTCAAAGGTT
GCGGTTGCTTCAAACCCCAGCTCGGCCTTAAATTGCACGCACCCGACCAATGTGCAAGTCGACGTTTTAATTGCACAAAGGTGGTAATGGCCACCATCCT
AATGTAATACCAAGACCATGATACTGGTGGAGCAGTGCACAAAGCGAAAAGAGCGTTACCGATGCAAAGGTTGTCCAGGTGCATTTGGCTGAAGCTGCTT
TACGGGGACTCACGAATGTGCAAGCTTGACGCTTTCAATTTAAATATGAGCAAGTAAGGTCACTTTTCATTTGTATGCATGGAATTATTGCCAAGAGCGG
GGTTAGGATATGCGATTAGCTTCCAACCTTTTGGATAATGCTGTCCACTTTCCTTTGTGGCTTGTTCTTGTCTGCGTGTGCGGTAAGCTGTAGTACCCAG
TGTACTTTATTACAGTGCTGAGCTAGCAATGTTTTAGAAAACCGTACCTATGGTCGTGAACACAGTCGACCTTAGGCGCTATCACTACGTTGACCATTAA
AAGAACGATGGCGGGGGTGGACGTGTTGATGTCGATTCCAATCGCGGCCACCATCACTGGGGCTTGAGAAAGTGGCCTTCGCTTAACCCCTGTTGGCAAT
ACAATAATTAAGCCTAATGCATAGCCGTCACAGTGTAGATTGGGCAAAGCAAAAAAGCCGAAAATGTTTGTGTATTCAGGCAAAAATGTTAGTGTATTTT
AAACCTCCCAGCAACATGTCTATCATAGCGAGAACAGTTGTAAGCCGT