Description :
From Genome Similarity Track
Location :
Scaffold_240:24839- 31820
Transcript NameFunction/comments
Phyta_totarag6053conserved hypothetical protein
Phyta_totarag6054putative 3-oxo-5-alpha-steroid 4-dehydrogenase/steroid 5-alpha-reductase
Phyta_totarag6055hypothetical protein PHYSODRAFT_513613
Phyta_totarag6056conserved hypothetical protein
Phyta_totarag6057hypothetical protein PHYSODRAFT_315046
Phyta_totarag6058hypothetical protein PHYSODRAFT_262310

Sequence
6981 bases(100 bases per row)
CATGTCCAAGTGGAGCAAGAAGAACCGAGCGCCCACGGGCTACGAGTACATCCAGCCGGTGatggacgcgctggagagCGAGCTGCGGGAGAAGATGAAC
GAGCCGCACGAGGGCAAGAGGCAGTGCGAGGCGCTGTGGCCCGTGCACCAGATCAACTGGCAGCGCAGTCGCTATGTGTACGACATGTTCTACAAGTACC
GCAAGATCTCGCGCGAGGTGTACGACTACTGCGTGCGGCGCAAGCTGGTGGACGCTAATCTGATtgccaagtggaagaaaCCGGGCTACGAGCGgctctg
cagcacgttcgcCATCAACTCCAAGAACTACAACTACGGGACTGTCAGCATCTGCCGCGTCCCGAGACAGCAGCTCTCGGAGGGGCAGGTCGTGCAGGAG
AAGCACAGCGGCTGCAGAGGCTGCGCGTCCGGACCCGGAGGGTACCATAACATCTTCGGCAATAAGTACGGACAGTACTTGGCCAGGATTCAGATCGCCA
GGGAAGAGGcggccgagaaggaggagaccaagcagGTGTGGGCcacggagcaggaggaggaagagtACGAGAGTGGAGgggaagagaagaagaggaagag
aggaGGAGAACCGACCAAGGAGAGCGACAGTGAAAGTGGCAGTGagagtgaggaggaggaagagaccaaggagTCCGAAGCgccctcgaagaagaagcag
aaggcggataagtgaagatgacgacgctgtggtAAGAAGAGTGTTGCTTGGTCTTTTGAATAGATTTCATGGATTTTACTACCAAACGAAGGGGAAGAGT
TTCCACTTGGGCAGTTTGTTGATTCGATCGCGAAACTTGTGCTCGACCCATTGAGAACTGATGTTCGCGAGCAGAACCTGGTTGGCCACCACCCAAGCAG
ACACGAGGTAGAGCATGAAGGTCGTGCCACCAGTGACCAAGATGAATCCCGCGTACAGCATGATCTCGGTTGTGTAGAGTGGACTGCGCACAGCGTCGAA
CCAGTCGCCGCGGGGGACCACGTGCTTCATATTGTTGGTACGCTTTTGCCTGGCTAGAAGGAAGTTGCAGCGCGTTTGGTGGTAGGACGcaatgacgaag
aggacgacgcctAATCCAGCCATCATCCGACGCAACGTTGTGTCCTCATGCCGCGTGATTGAATCCGGGTCGAAAAGGACAGACAACACCGTGGCGACGT
AGTGATAGGTGCCTACGAAAAGTACTGAACATCCCACAACCACGGAGCCACTGTCAGTCCAAATTCCCAGATTAAAAGCAAGAAATTGCACCATAACTTA
CTGCAGGCGTGCATCTTGGCGTCACCAAACTCAGTGACCAGTAGCGACTCGAAGAAGCGTCGTGTCGTGTGCACCGCAAACAGCGTCAGGAACCCGATGG
TGTGTGGCTGGATCATGACGACATTGCTGCGTTCTTGGTCAGCCGAAGGGTGCGCAAAGTGTAGAGCATATTGAGCCACTCGAGTCTTCTGCCAAAATAC
TGCAACAACCAGCATCAAGATGCTGTGTAGAGCTCCGATGAGGTAGAACCACGTCCAGTAGCTCTTGGGCACCtccacacgcagcagccacaatCCCGGA
AGTTGTGCGACGGTGACGGGTGTGCGCATCTTGCCCTGTAGAACGAACCCACGGCAGAATTTACTCCGAAATGATAGCAGTGCACCAGCCACGGCTACCA
GCCACGTGAGCTGCCACAGATCCAGCATCCCCATAGACAGCATGGTACCAGCTAGACGTGgtttttgaccaatcatgCCTGTTAGAATGACATGCATCGC
GtggacatggctacattagTACAACGGGTCCTGCGTCTCAATAAAAGTCGAAGTGGTCTATCAATAGTGGAATCCTAGCCTGATAAGAACGCGTGCTGGA
CATGAAGCCGCTAACAATGCAGCATAATTAGCAAGCATAGAGTTGGCTACTAGTATAGTCGGCGTGAAGACGGCATTTGCAGAAATTCCGCACGAGTAGC
TGTCTAGTGCAAGGACCCGTTCAGCAAACATGATATCGCGAGGTTCCTCTATCCACCACACGCGCCGCACTAATAACCCGTTCATGACCACAAGCTCTGG
GATTGTCGGCATTGACCTCCACGAAAAGGTGGCATTTGACGCACCTCAGctccgcagcagctcgagcaacaACCAGGTCGGAACGGGCCAGCCGCGTTCT
ACAAATGCGTTGACGGAATTCATGTATCAAACGACATCGGGGGCTCTTGGCGAAGGTGTCCGTGCGCAGGAACGCTCGAGGCTGAGCCAGCGGATGGACA
AGCTCAATCTATACAAAGGTGCGTGCTtcactcgctgcagcttgatcCTATTGTTGACGAACGCAAGCACCACGACTGATTTGATGCTTGCCGTCGTGTT
CTGCTGAGCAGAGGTGGAATCTTCCGGCCTCGTCACCGTCCGACAAGTGGATGTAGCAGCACCAGAAGAGTTTGCCGTCCGCCCAGAGATCATGCCCAGG
GCCATCGACATCAAGGCGATCACCGAAGCACAAAGCCAGCATCCTCTGTACGCCACAAGCTATCGAGACATTGGCGCCGTGAAGACGCAGCTTAAAGTCG
AAGTCGACCGGCTCGGTCGGCCGAACACATTCACCAACTCTTTCAACGGTTTTCGCTACCGCGACTTCGGCCTGAACACCGCTGTGACCAAGTCCCGCAT
CTCTGACCAGCTCGACTACTCCTGAGCGTGAATCTCTCTTCCTACTATGGATACCATCCACTCACAAATCAAAAACTCCCACCAAAAATTCTACCAAAAA
CACCATTTTACCCGAATTTTTCTCGTTGTAATTGCGTCAGTCACATCCTGCCAGCAATGGTAGGGTAGCACTtttctctccttctccaccgccaaGGTAG
AATGCCCCCGcttcgatctcctcgtccacatAACCAGTTATACTGCGCTTAGTCGTAGCCCTTCTTCGAGAAGTCCACGAACACCGTCTCCTTGGCGGGC
AGCGGCGTCATGTCGATGTTGATTCCctccagcggcgacagctccacgtcctcgggGATCTCTCCGTCCGGGAAGCACACGTCCAGCGGGATGGGCGCGT
TACGCATGAAGAGACTGCCGCCGGGCATGTAGTTGAATATATAGCGGTCTGGGTGCGTGTAGTggtccaccttctcctgcgCCTCGCGCACCAGACGCTT
GGCCAGGCTGAAGCCACATCGAACATACACAGTAAGAGAAAGTATCAACAGACCACCGGAACGACGGCAGACAGACGCAGAATctgaggaggagaaggag
gtaCGCACCCAGACTCAGGGTCCAGCTGGCTGCTGGCGTCAAACTCGGCGCGGATCTTGGTGGCCTCCTCGTTCCAGAGACGGCGGTCGATGATCCACGa
gtccagcgtcttgagcgaCTGCTTGTACAGACGCTGCACCTTCTGCTTGTGCGAGAGCTTCGGGGGAGCGCCCACGAAGCGCCCCACCACCTCGCGCAGG
GTCTTGTTCATGTTGGGGTTCACCACGGGCTTCACCATCGTCGCCTACCTGAGTCGCCTTGCGTCCTGCCTGCTTAGCCTGCTTAATCCGTCGGTCCGAT
TCAGCGGAGCCGCACACTTTTTGTTTTCGTTCGAGCAACATACTCTAATGTTGCACGAGTGGAGCGGTCCGGCTCGTTGTAACCGGTTAAAaaagaccat
cactcttgacttcaacttgcataAGTTGCAGCTATATTTGCTCTGCATCTTTAGATAGCCGTGTGTTTGGGATATTATATCGCTGGTAACTATATGGCGG
TTGACAGGACGTGGACGGACGGCGTGGGCGGCCAGGAAATGCGGCCGTCGACGTCTGCTGGGAAGAAGACGCGTAGGATGTCGCTCAGCAGAGAGAAAGC
AGGGACGGAAGAGCCTGAGGCTGCTGGtcccaagaagaacaagaacaagacCAAGCGCCGACAGAAAGAAGACGCAACTCGACAGCTCACGAGTCTTCTG
AGGACTGAGAGCGACAAACtgagcgagcagctgctgatcGCGAGCGAGAAGGGCAAACAGCGCGCCGTCTTCCTGCTGTTGCACCAAGGAGTCGACAAAG
ACCGATGCAGAGGCCTCGTGGGTGTCGTCTTGCTTCTCGAATGTACTTAAGAAAGTAAAGTTGTTCTAAGTATTATTGGTGAACTTGTTGTGCAGCTCGG
GTACTCTCCGGTGCATCATGCTGCAGCTAGGGGCCACCTGGAcgtgttgcagctgctgctcgacttTGGCTGGAGCGTTGACGTCCGCAACGACGCACTC
GAGACTCCTCTCCATCTCGCCTGTTTTGATGGGCATGTTCACGTTGCGGAATACTTGCTGGACCGAGGCGCAGACATCAACGCACGGACCAGTGACCAAG
AGACCCCTTTGTTCTACGCTGCGCGGAAGGGTCAATACCGAACTGTTCGCCTGCTAGTTCGACGCGAGTGTGATCTTGGAGCGAAGAACTGCTACGGTGA
TGtggcggaggaagaagctcgtgatGCCAAAACTCGATCAGAATTTGCAGCGGGGAATGAAGATCTGCAGCGAGCCTCGGCTGCAGAAATGCAGCGAGGG
AAAACGAGCGAAATGGGGGAACACATCGTATCCCAAAAACTTCGAGAACGGGTGCTATCGTTCTTGGATCTGAAAAGCCTAGGTTATGCTTCGCAAGTGT
CGTACCGGTGGCATCGAGCTGCGGATAACTCATCCCTATGGAAGAAACTCGGCGTCTCACGGTGGGGATTACTGTTAAACGCGACCATGGGAATGGGGAC
GGTACCTCagatggcgatgctgcgTACTGCTACCAGCAACCTCCTACGCTTAAATCTCTCTGCGACTGCGTCTCGACGTCCATCTAGCTGTGATCAAGCT
GTCCTCGGTAGATTAATGCCGTTGAGTGCTAAGGAAAAAGAGCGCCAGCGGTATCGAGAAGAGCTACGACCTCGAACAGCAAATATTGCAGGAATATAGT
TGAACGCTTTCACGCTTGATGTCCCCTCAGAAGCTCACGCCTCAAGTAAGCAATCAGTCGCTCTGAAAAGTTTCCATTTACTGCCTGCACAAACAACAGC
CCCAGCAAACGGCGATGCCGCAAGTGGAATTCTGCTACCTAATAAGCGTAGCGCTTTCGACCAGTGCTTCACTATCTGCATTGTTATGgcttgttgccgt
tgcctTTGGGTTCCTTCCTTACACAACCGTGTGCGATGCAACAAATCTACACCGCGTCGACTCTAATTTTTGCAGTCTCTTTCGTTTCCCAATCAGGATT
TCCTTGATTCTTGCAACACGACAGACGTGGTGACAACTGGTGCGGAAACAAGGCTATGTGTCTTCCTTTGAATGCATCTTCGCCGTTCTCTCCATTCTCC
GTTAACCCGGGCAAGTACTTAATATCCGGATACCAGACGGAGTGAACCAGGCGCGTGGATTTAGGTTCGATCAAGTATCTGGGATTTTGTTGCATGATGT
ACAGGTGGTGAGTTCGACTATTATTGGAAGGCAAAGTGCCAAAAGATGTGCCAGTCTAATCAGCGATTCGATTTAGGACATTATCTGCTTGTGGTTTTAT
CTCGTCGAATCAAAAGGCATAACTCACACATACAAGTCGATTGCACGCTGTAAGCCTCCTTGGTGTTGTAATGCGTTTGAGCGTTTACACCGTAGGCCAG
CCACTTGAAAAGTCGAGCTGGTTCCAGCCAAAGCGCTTGTCACCATCGGCATATCCGATGCGAGTGTCCACTACATAGCAATGACGAGTGTTTCACACGT
CAGAACGCAAAATATTGGACACGGGGAAGTGTGAAAACAAATGAGAACCCAGCTTACCGTAGTGATAGTACAGCACGGGGCCGTACTTCGGGTCGTTGTA
CACACCCTGACCTCCCGGTCCATAGACCCAGTCGTGCGACTCGAGCACGATCGACCCACCGTTGTTTCGGCAGTCGACTCCGTTCTTGTCGACGAAACCT
GACGTAGGGCTCTTCGACCGGCACACAAGGACGCGGTACTCCTTACCCTTGGCCGGTCGGGTCTTGTTGTAGCCGCAGCAAGAACccttggagaagaaga
ggtaGTAGTAGCCGTTGTGGGCAAACTCAAACGCagcttccacgacttcaTAGTTCGAGGTGAAGGCGATTTGGTAGGCGTTCTCGCCGGTACTCTTCGC
CGGGAgcgacgacatcttcgtTTGGTGGAGCCCCTGCCAGTAGCTACCAAAGTTGAGGTAGTATTGGCTGCCGACCTGGATGAGATTCGGGTCGATAgcg
ttgtacttcttggaAGCATTACTCGTGACGCCCACACTACCCGCGTCAACCCACGACCCCGGTTCCATGGTCTTGGACCGCGTAAGACCGATGGCGGAGT
CCTGCGTCCCGAAAGCGCTGACCGAGTAGTAGAGGTAGTACATGTCGCCTACCTTGTTCACCTCAGGAGCCTAATCACAATACACGCTTGCTTTATTAAT
AGTGCCGTGACATCAATTTGTTTGCAATAATATTTTGCTTACCCAGAGATCATCCTTGCCCTTCAGATTGATCTTCGAGCCGTCTGGAACGGCAGCACCC
AAGTACTTCCAGGGACCCGTGAGTGCAGGGGCAGAGTGGATGGCAATCTTGTTGCCCGTAGAAAAGCGGAAGTAAGTGCCGTCGTCACGCCGGATGATGG
ACGGATCGTGTGCGTTGGTGCAGACGCCTGTGCACGTTTGCGGATTGGCATATCCGCTGACTAggccagcgacgaggagaggGAACCCAACGAGCATCGA
AAAAAGCTTCATGGTGGTGGACTGCTAACTATGTAGAATCGGGCGGTGTGCGTGCTGACTATCTAAAGCGGAATTCGTGCCTCGCGAATCTGACTGAAAG
TGAAAATGCAGCATACGGCCCGAGCAGCTCTGCAGTCTATCTCGTTGACTCATGCAATGCTTGTCACAATTCTGTGATCCA