Description :
From Genome Similarity Track
Location :
contig_37:248370- 250004
Transcript NameFunction/comments
g8930.t1XP_009523615.1 DNA photolyase [Phytophthora sojae

Sequence
1634 bases(100 bases per row)
CATAAGACATCTTCATGCCGGCCACGCATCGGGACATCGATTCCTTGTGGTCTACAATTGGGCACGGATAGTCTTTGCCGATGATGCATCCTGTGGCATG
CTGCAGAGTCATTGGGGCCTTCCACGGTTCATAGATATACTTGGCAGGCATCTTCTTCAGCGCCGGGATATATTTACGAATGAAGTGGCCTTCCGGGTCC
GATTTCTTGCCAAAGCTGATCGGGGAGTACACGCGGAAGTAGGCCGTGAAGAAATAGCTGCTGCTAAGCCAGAGCCAGTTGCCGGCGTTAAGACTCCAGT
CGTGGTCTATCAGGTACTCTTGGAAAACCTCGAGTCCACGCACCCACGAGATGTACAGATCACCGCGTGTTAGGAAACATGCTACTGAGTGACGCGCCAA
GTGATGCATCCAGCCTTCCTCCTTCAGCTGAGTCATGATGGCGTCGATCCAAGGGAAACCAGTCCGACCCTCTTTCCAAGCCTGGAACTGCGAGCGAGCG
AGCTGGTCGTCATCAGTCATGTCCTCCTTCTTGTCAGGAATTATGTGCCAACGCCAATTGACCTGCAGACACGTTGGGCTTTCTTCCATCTTGTCAAAAT
ACGGATTCGCATGACCATGGCAATGGTAGAACTCCCGCCAAAGAAGCTGTCCTTCCAAGCTCACAGGAGGCTGCGACATCATTTTACTGCGTTCTTGAAT
CGCCTTCAGTTGATGAAAAAACGTCCGGGGGCTCATGCAGCCGTAAAACAAGTATGGGCTCAACGCTGTCGTCGAGGGCGTCGGGGGTATCTGCGCCGGG
GACGTATCGGGCTTTTCAAACTTGGCGACACGCTCTTCATCTTTGCAGTACTCTTTCAAAATGCCCAGCGCTTTCTGCTCTCCACCATACAGGAATGAAT
GTCTCTTGATAGCCTCGTAGCCAAAGTCCGTCAATTCTGGAAGCGTAAACAGCTTGTCAGGGCCCGCAATCTCATCAAGTTGGTTGTTTTTTTCTTCCGG
ATCCTCCTCCTCCTCCTCCTTCCTCCTTCTGTTTCACCACGTAGTCCACCTTATTTCTATCCTTCCAGTAGTCCAGAACTAGTTGGTACAGTTCACTGGG
CTTCGAGGCCAAAGCAGGCAGCGTCTCTGGCGTGGGAAGAGGCTTGGGCGGTTTGCGTTGCTTCCCCACTTGGCGAAGGAACATCTGGTAAGTCTTGGGA
GCTCTGCCTCCATAACCTTTGATCACTGCATCCAAATCGAACAGCTCGTAGCCGTGGGTCACTTGCGTCTGTACGCCCAGGCGCTTGGCCAGCGTCTGGA
CGCGATTGTCCCTTTCCACGGCGTACGGCTCGCTCACTGCATCAAAAATGAGGTGCGTCACACCCCAGGTAGGAAGCAGCCGTCTTAGTACTTGCAGTGC
GTCTCCTTTTGCCACCACAAGTCGCGAGCCGCGCGTCTCCAGCGCTTGAGCCAAGTCCTGGACGCTCTCGAGCACAAACTGGAAGCGGTTGGCGCCGCAG
CGCATGATCTGCGGGCGGTGGATGACGTACAGCGGGATGAGCTCCACCCCTTGCTGCTGCTGCATCAGCTGCAGCGCCGCACTCAGCGCCAAATTGTCAT
GCAGACGCAGGTCTCTCCGGAACCACACGACCAC