Description :
From Genome Similarity Track
Location :
contig_37:248346- 249980
Transcript NameFunction/comments
g9355.t1ETK96214.1 hypothetical protein L915_00962, partial [Phytophthora parasitica

Sequence
1634 bases(100 bases per row)
CATAAGACATCTTCATGCCGGCCACGCATCGGGACATCGATTCCTTGTGGTCTACAATAGGGCACGGATAGTCTTTGCCGATGATGCATCCTGTGGCATG
CTGCAGAGTCATTGGGGCCTTCCACGGTTCATAGATATACTTGGCAGGCATCTTCTTCAGCGCCGGGATATATTTACGAATGAAGTGGCCTTCCGGGTCC
GATTTCTTGCCAAAGCTGATCGGAGAGTACACGCGGAAGTAGGCCGTGAAGAAATAGCTGCTGCTAAGCCAGAGCCAGTTGCCGGCGTTAAGACTCCAGT
CGTGGTCTATCAGGTACTCTTGGAAAACCTCGAGTCCACGCACCCACGAGATGTACAGATCACCGCGTGTTAGGAAACATGCTACTGAGTGACGCGCCAA
GTGATGCATCCAGCCTTCCTCCTTCAGCTGAGTCATGATGGCGTCGATCCAAGGGAAACCAGTCCGACCCTCTTTCCAAGCCTGGAACTGCGAGCGAGCG
AGCTGGTCGTCATCAGTCATGTCCTCCTTCTTGTCAGGAATTATGTGCCAACGCCAATTGACCTGCAGACACGTTGGGCTTTCTTCCATCTTGTCAAAAT
ACGGATTCGCATGACCATGGCAATGGTAGAACTCCCGCCAAAGAAGCTGTCCTTCCAAGCTCACAGGAGGCTGCGACATCATTTTACTGCGTTCTTGAAT
CGCCTTCAGTTGATGAAAAAACGTCCGGGGGCTCATGCAGCCGTAAAACAAGTATGGGCTCAACGCTGTCGTCGAGGGCGTCGGGGGTATCTGCGCCGGG
GACGTATCGGGCTTTTCAAACTTGGCGACACGCTCTTCATCTTTGCAGTACTCTTTCAAAATGCCCAGCGCTTTCTGCTCTCCACCATACAGGAATGAGT
GTCTCTTGATAGCCTCGTAGCCAAAGTCCGTCAATTCTGGAAGCGTAAACAGCTTGTCAGGGCCCGCAATCTCATCAAGTTGGTTGTTTTTTTCTTCCGG
ATCCTCCTCCTCCTCCTCCTTCCTCCTTCTGTTTCACCACGTAGTCCACCTTATTTCTATCCTTCCAGTAGTCCAGAACTAGTTGGTACAGTTCACTGGG
CTTCGAGGCCAAAGCAGGCAGCGTCTCTGGCGTGGGAAGAGGCTTGGGCGGTTTGCGTTGCTTCCCCACTTGGCGAAGGAACGTCTGGTAAGTCTTGGGA
GCTCTGCCTCCATAACCTTTGATCACTGCATCCAAATCGAACAGCTCGTAGCCGTGGGTCACTTGCGTCTGTACGCCCAGGCGCTTGGCCAGCGTCTGGA
CGCGATTGTCCCTTTCCACGGCGTACGGCTCGCTCACTGCATCAAAAATGAGGTGCGTCACACCCCAGGCAGGAAGCAGCCGTCTTAGTACTTGCAGTGC
GTCTCCTTTTGCCACCACAAGTCGCGAGCCGCGCGTCTCCAGCGCTTGAGCCAAGTCCTGGACGCTCTCGAGCACAAACTGGAAGCGGTTGGCGCCGCAG
CGCATGATCTGCGGGCGGTGGATGACGTACAGCGGGATGAGCTCCACCCCTTGCTGCTGCTGCATCAGCTGCAGCGCCGCACTCAGCGCCAAATTGTCAT
GCAGACGCAGGTCTCTCCGGAACCACACGACCAC