Description :
From Genome Similarity Track
Location :
Scaffold_31:248334- 250478
Transcript NameFunction/comments
Phyci_573321Hypothetical protein
Phyci_221440hypothetical protein PITG_03798
Phyci_79826eukaryotic initiation factor 4E, putative

Sequence
2144 bases(100 bases per row)
TCGGGAGCACCACACGTTGGCGCACCTTGCACGCCATGGACTTGTGTGGTAGATTTCTTTCTGCGGGTTGCTCGCGACTTCGGCTGCTTGCATGCGGTGC
TGCTTTTGGCAGATAGATTTTTGCGTGCCGGCTTCGTTGTCCAGGTCCCCGTTCTTCGTAGTCCGGGCATAAAGATCGCGGAAAGTGGTCCTTTAAATTT
ACAGAGGTATGGTGACGACAAGTGATCTTCCAGGTGCTTGATCTGCAGCCGCACGTCGCGTGGTTTACAACCCAGAAGCCAGGCGCCTGAGTGGCAACCG
CCGCTAGCATCATGTATTTTGTCTTCATTTGCTTCGCACGGGAATAGGCAACGTAGTGTTCACCGAGCCAGTTCACAAGAATTTCCATTCGGCTTTGACC
ATTGCGCCCAGGCTTCAACCATTGCAGTATTGGATCATTCCTGTAAAAAACAAGGAGAACAAAATGTTCAGGAACCACTCGTTACTGCGTGGTGGGCAGC
ACACACTTGCCTGATCAGTCTTGTGATCTGCGCCAGAATTTCGTCGATAGTGCACCCGTGAAAGCCTGCCGCCAGCAGGCCCAGGCGAAAGTTTTCCGCA
ACTTCTGCAAGGACCGTAGTTTGTCCCCAGCCACTTGGTCAGCATATCCTTCGGGGTTTTGCCATTGTGTTGCGCTTGCCACTGAAAGCGCAGCGCACGC
CGCTGACTCTTATCCATCGTACTTGGAAGCTGAATGCAAAATGAGCGGATGACTGCATACGTGTGGGACGAGTTGTCCCTAACGGGGACGAGTTGTCCGA
CCTATCTGCTGCGTTGCATCACGACAACGCGGCACAAGTTCGAGGACCTTGTCCCATGTAGAATTACCTTCTCAATGAGAGTCTCACTAGGCTTGCTCTG
CAACATGTCAAACTGGCGCAAGTCGGACCGCATCAATGCTTCTTTAGCTGCTCAAGACACAAGCCCGTGGTTAGCTCGGACTCAAAAACCCTGATAAAAC
AAGAATATATTGCCATCCGTCTTCTGTGAACAATAAAAAAAGGAAAGGTGAACTCAAAAGTGCGATTGCACCAAAGTCGGTGCAAAACCAATTCGCGTCT
GAAAAGCTCAATTCGTACGCCATATCCAGAACTACTCAATAGAATTTAGATCGGGCTTCGAAGAGTTCCGCTAGAAACTCTTGCACGTCAGTAGGACGCT
CGCGGACGGCGGTGTTAGTTGCTAGCACCATGAGGTGGCGGACTTTCCGGTCGAAGTAGGTTTGTCGTTTTAACTCCTGCATCCAAACCGCAAAATACGA
CAGTGAGTGCCAACCTGAATCTTTACTGCCTCAACTGTGCGTACCACGTAGTTGTATTTCTTGAGGTTGAGAGTGCCACGCACTGCATTCGCGAGAAAGT
CGGCAGTCTGATCGGGCTGGTAGAGCAACACCTCTTCCAGCACCTTCGTCAGGACAGGATCGACTTTCGTGGTGATGTACTGGTAGGTTTCATCCAGCGC
AGCAATGAGATGAGGGTCGTGCATCCGATAGCGTTCTTGTTCTGCGAACGTCAGACATTGATGTCAGGATTCGAAACCAAACGTGCACCACACACGAAGT
GATTACCATCGCGGATTAGAGCTGAGATCGCAACGCCCTTGTTGCGGATCTTCTGCGATTGCTGCTCCATGGTCCAGTCACAACCGACGGCAAGGAATCT
GCCAGAAGGGAGGGCGAAGGAAGCGACAAGAATGATCCGGCAGCAAGACTGGCCTCCTGCCGGCTCGTATTTTTAGGTGGCCGCTGCAAGTCTTCATCTT
CGAGTCGTATTCGGGTCATACTTGCACACAGAAGTTGACTTATCGCTCTTTGAGCGGTTAGCTATTTGTCTGCTCCTGGAATCACGCTACTCCTTGCTCC
ACGATGACCGCCTTAACTCATGTGAGTACCTACCTGATCAACAGCCCCAGCACTGCTACTATTGCCAGTACTGCGGTACCTCCTTCCAGCCTGCAGTCGA
CCTAGTGATCGCCCTCACCCTTGTCATCATTGGACCTGCTGTTGCGGTGGTGGCCGCCCTCGTTGCTCTCGGACTTGTAGAACGAACGTTTATTCTCACG
GCCCCACGCCTGTCGCTGGTGGCTAGAGGACTTGTCGCGGGAAA