Description :
From Genome Similarity Track
Location :
Scaffold_3:2483038- 2484419
Sequence
1381 bases(100 bases per row)
CTACTGCGCAAAGGCCGGGACCTGGATGGCCACTGTGACTTAGGCGGGATCCCTGTCGGCTAGAAGGATACAAGCATCTTGTGGAAGCCCCCCTTTCGGA
ACCAGCACTTGTGCAGTAAAGAATAAAAATAGAGAATGAGAGAGCGTAATCGTTGACCTTTGAATCTGGTATGAGGTCATAAATGCGTTTCTAAAGCATT
TAGGCGTTTTAGATGCAAGAAAGAGCGTTACTTGTATCTAAAGCGGTGGGAGCCTAGCGGTGACAAACCCATTCTTATTTAATGCATGTACGTTAATGAC
TCGACAGTTGCAGGGCCACATTTGAGCTCGTCTAACAAGCTAAAAGACAAACGCTCTGTTAAATTTACATTGGAAGATTTACTTTCGGTACGTTGCACTA
CTTGCTTAGAATGAAGATCAAATATGATCTACTCAGCGTTTGTCGCAGCAAAACTATATCAACGACCTTTTAGAAACGTTTCAGATGAGGAACTGCGCCA
CCATACCTACACCACAAGCTAGATGTGTGACCCCAGAAAAAAACCTAACATCAGAGCGAATATCTGCATAGAGGGTTAGTGTGCTCTTTAATGTATCTAG
TTAGAGGAACTGACTTCCTTACGCCTTCGGTAGCGGTCCCTAAATCTGTTCCACTGTATAAAGACTAACACAATCTTGCTTAATACGCTTCCAAGTAATG
CATGTACCCCGAGCAATGATACCTATCCAGTAATAGATTCTCTTCCCTCATTTACATTTGTGAGGCTCGCGTCTGTGTATAGCTCTATCTTAAACGTACT
ATTATTTGCCATACTTTGACGTTCCTTTCACATACTTTAGTACTCGCTGAGCCGCCCTCCATGTGCCTCACTATAGCAAGACGAGTATTTACTCAGCTCC
CTAATACCATTGGCTATATCGGGGCTTATGTGGTTAAGGCAATGTTTAAATCAACAATGCTATGACTAAGTGCAATCAACACACTGTTAGTGATAACACT
ACGACAATGGGCGTTATTGAGAACCTATGCTGTCATTCGTTCACTAAACACATATATTATGTATCTTAGTGCTCGGGACAAGAGTGTTTCATACTGCAAC
ACATATGACCCTTTCTGCTTGCAGTCTCTCCAATTAGCGGTTAATGCTCCGCTACTGCGCAAAGGCCGGGACCTGGATGGGCCACTGTGACTTAGGCGGG
ATCCCTGTCGGCTAGAAGGATACAAGCATCTTGTGGAAGCCCCCCTTTCGGAACCAGCACTTGTGCAGTAAAGAATAAAAATAGAGAATGAGAGAACGTA
ATCGTTGACCTTTGAATCTGGTATGAGGTCATAAATGCGTTTCTAAAGCATTTAGGCGTTTTAGATGCAAGAAAGAGCGTT