Description :
From Genome Similarity Track
Location :
Scaffold_1687:2482- 3838
Sequence
1356 bases(100 bases per row)
CTCCCACAACGCGAACCCGAGGTCACCTTGCTTACCGCCGTCACCCCGAAGGTTCGCCCAGATCATCTTGAGACGGGTCTCAATCGGAGCACGCTTGGAG
ATGGGGACGCTTGGTTTGAAGTCGACAGTGTCAAAGAGGCAAGCTTGAAGAGGATAAAGCTGCCGAAGCTGCTGGTACGGGTGATCAGGATGCGAATAAT
TAAAGAACGCTTGGAGACCCTCCAACGTTGTACGCACGGTCACCTCACCAGCTGGTTCAGGAAGCGTTAAGCTCAAGAGTCGCTCGAAACACGTCTTGGC
GCCTGCATCGGTAAACTCCATGTCCACATACGGAAGAACCCACGGTGGCAGGGTGGACGAAGCCGGCACCGTAGGGCGAGTACCAGATAACACTCGGTGA
GACAACTGTGGTGTAGCGGGATCAGCAAAATCTGCGAGATTGCCAGATCCAACTTACCAACTGCGCCCAGACACCGACTAACGGAGGGGGTCCCCCGATG
ATCCGTGTTCTGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCGGGATCTGCTCTCTCGGTAACTTCCGAAGAGTTCAAGTGGTGAAGCTTGAG
TGTCTTGGCGAGACGTGGGGATGGGGTGGAGCAGCAGTGGAAAATCTTCACTCTGCGTCCGTGGATGGTTCCGTATCCTAAGCGAATATTCGAGCTTATG
GATCCGGGGCCTAGATCGTGGATCTGGCCGTGGGGTTGCCTTGCGGGTGTGTTCCCTTGCCTTTGTGTTGTCCTTTAAGTCGTACTTGCCGCCTCCTGTG
ACGGGATCTTGAGAGTTGAGAGCCCCTAGGGTGTAACCGACCAAGTAGTAAATTCGGTTAACCTGTCGGATCTGCACAAGTAAAGGAAAAGCTCACTAGG
TTGTAGGATCTGGCCAATGTATTATCCAGTTATCACTACCAACACTAGATTCGCAATTCCCAACCTTCTCGGAGCTCGTACGGCCAATGTAGTTCCGGTT
CTTGAGGGCAGGAAGGCACTTGCGTGTCACTGTGCAAATTGGAGTCTGTATTGATATTTAAGCCTATACCTGCCTGGGTTTCTACCTTCTATGTCTTTAC
ATCTGCTAAATCCCTTACCAGGGCTCGGCTGACATGTCCCTTCTTCCCTGGACCACATACATCCCAGCTGTGTTATCTTCCCAGCTGTGTTATCTTCAGA
TCCCCCGCAGATATGTGACATAATCATCATGGTCACCCTATTATGGGTACACTCATCCGGATCCAGGTCGCTTGGATCCACCTCACTGTAATGGTACACT
CGCCGTGGATCCGAGCTCTCCAATCATCCAACATCATCTCGCAACCGTCTGTGATC